CR00684

CRIMIC CR00684

Gene boca

CG30498

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78984

Images

Construct Sequences

sgRNA sequence
GTAGGTAACAACACTGCGATTGG

Amplicon 5' Amplicon 3'
GCTAGGTTGGAGAGATCCGCATTGAGAATGCTGGGACCGATCTTGGCTTGGACGGGCATCTTCTTGGTGGAACAGCTACTCAACAGGCGGAGCAAGTAGAGCACGTCGCGGTTCGCGGGTGGCGTCTTGTTGACTTAAGGTCACACAGAGGGGAGCTGGAGCTCGAAACATTTGAAAGGCGATACGATAACTTTGCCGATGGCACCGTGAGTTGTGTAGTTGGTCAGCGATTAATTTAGAGTTTTGCTTAAATTTTTCATTTATTTTGTTTTTGATTTGACACATACGCAGTGTATATAAACAATCTAATAGAGATACAAATATTATATTCAAAATATGTTTATTGAAATATTCATATTTTTATCCATATTTATTCCATCCCGCAAACGGAGCCGTTTCCCTGTGAATGGCCAAGCAAAATACATATGTAGCTTCTTTAATAAGTTTGTTTAATAAATTTGTTTTATTTTAATTGAACTTTGATCTTAAATAGTGAGAATGTTTTGATGTGCTGGTATGCCGTGGAACCGGCCTACAGTTCGTCCTTTTTCGCATTGACACCTGGGTACTCCTTGTTCTCGATGGTTACGCCCTTGCAGCGTTCCTGCTCGATGAGGAAGTCCTTGGCGTCCCAGGCTTGTGTGCCGTCCTTGAAGAGGAAGATGGCGCGGTTATCGTCAACCATGTAGCGCTCCGCCTGGATGTGGTTGTTCCAGAGGCTTGTCTGCCAGAGCTTGGTGATGGTGTCGCTCTCCTCCCGGGTTGGATTACCGGTCACCGAAACGAAGGTCATCAGCGTGCGCCCCTTTTTGGACACCTTGAGCAGGTCCTCGGGGCTCTTGCTGTCCAGATTGCTCAGGTCCAGCTTGGGCTGGGGGCGCAGGTGCTCGGGCAGCTCATCATCCTCGAGGGGCTCTTCATCTTCCTAAGAGAAGATTAAAAGAAGGGGTATCAGTTATCCGTCTCTACAAATGATGAATCCTTAGATAGGTGGGAATCTAAAGGGTTGGCATTACTCCCTTGCTAGGTGCGAATCTGGAGAGTTGGGTCCGATGTGTCGCTTTCCAATCGCAG CCTCCCATTGATCTAGCAGACGCTCGAGGTCCGCCTCGCTGTAGTCGCGTATATCCTTTTTGGCCCACGCCGGTTTCTCCTCCTCCTTGAACTTCTTGGCCAGGACGAGCGGGGTCAGAGCTAGCAGCAGCAAAACAAGACGTGTTTGCATGGTGTTTTATAAATATTTTTCCTATAGCTCAGCAATTCGCACGGTCAAACACGTCACCTAACAGTTTGCCATTCGCCCGGGAACGCGACCGAACAGCTGATTGAGCGTCCCCAGGTGGAGAACGCAAACGGAAAACACAACAGCTGTTAGTTTCGGGCGAGCATTTAAAGAACGCGCATCGCACGGAGTTACTACTTTTTTGTCGCGTGGAAATGCCGCTGGTAATTGGGTGCAGTAAATAGAGATAAGAACGGGCGTTGCACACGTGCTCTGGAGTGGAGTAGTGAGTTAATCGCACCAGCCCTACTCCAGCTGACCCTGGACAATCGTTTGGCTTGTTAGTTTATTTTGGAACAATGGGCCTGGCGGATTGTGCCAAAATATTTGAAATGCGTTCAACGATGACATCATCGACATTGTGTTTTAATCCGTCTCTCCGTTCCATCTGTTTGGTTTCTGTGTTTACATATGCATGTATTTTAGATCAACTATAGACCGCACAGCGAACGCCAGATTGTTTGAAGCACTCACCACGACCACATCA


Search Again