CR00683

CRIMIC CR00683

Gene ncm

CG12750

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78983

Images

Construct Sequences

sgRNA sequence
CATCATGTTTGGGTAGAATTCGG

Amplicon 5' Amplicon 3'
GTTTCGGTGGTTTCGGTGTGGCGTGGGGTCTTTGAGGATTTGGATTTCGGAGTGGAGGAGGATCGATCTCTTTTGCGTTCTGGCGACCTCTTCTTTTCCCTCGAATCATCTCTACGCCTGCTGCTGGTTGGTTCGCCCTTTTGATGGCGCTTTTCTCGCTCCTTGGCTCGCTCTTCATCGCGTTTATCTCGCTCCTCATGACGTCTCTGTCGCTCAACGCGTCTTCTCTCCAAAGAATTGGATCTGCGGCGGATTGGACTTTTACTGCGACTCCGGGTCCTGCTGCCTTTGCTTCTCGAGCGACGACGACGACGGCTGCTGGGTGATGGACTCCTGCTGGATGAGCGTGGGCGTCGTCGTTTGCCATCCGGGCTGCGGCTTTGTTTTCGTTGGGTTTCTTTGGGTGGACTCTTAGATGCGACAGCTTTCTTTTCCTCTTTAGTCGGTAGGTCATCTTCGTCTTTCTAAAAAATGAAAATTTATCATATCATGATGATGAAAAAACTAGCTGATAAATGATTGTGTTGAATTAATTTCATTAATTAAATAATTTGAATTTCATTGATGACGAAATAGTAAAGCGGCTTAATACCGA TTACGTCGGTTATCTCGCCCTCTTCGATGTGGTCCGCAGTGGGAGGTTTCACTGTTTCAGCTGCTGCTTCCACCGGCGATTCCTTGCTACTTCCATTGGTGGTCACTGGCTGCTCTTCATCCTTCCTCCGCTCTTCTAATTCCCGTGCAGCGTTTTCCTCTTGGGCCTTCGGGCTGTTCAGCTCTTTCGTCACACTTGAGGCTTCTGCTTCCTCTTTCCGCTGGACAGGTGTTTCAACTTTTTTCGCTTCATTTAATTTCTCGCTTTCCGCCTCCGCAGCTGCTACTGCTTCTTCTTGCTGCTTTTCCACGCCAGCAGAATGGGAAATGTGCTGGCGCTCCGAACGAGGCTCAGCCGCAGGAGTTTTCTTCTGCTCAGTGGGCTGCTCATCCTGTCCAGCATCCCTCTCCTTGGCACGCTTCTCCCCCCTATCCGTATCGTCAGTTTTCTTGGCATCTTTGGCGGATTCCTCCTGCTTTGCTTCCTCTTCCTCGCGCCCGCTGCTTTCGGAGGACGAGGACTCGCTCCTGGCGTCGCTGTCGCTGCCACTGGAAGTGTCGCTGCTGCTGGAATTGCTGCTCGAATCGCTCTCGGCATCGCTTTCCCCCATCGCGCGTTTATTTCGAGAAATTTTCAGGGAAAACAACGATGAAAATTATTGGGCAGCAAAAAACACAACGCGGCGATAGAATTAGAGATGGGACACCAGTGGCGACGGTATCGATATACACATGTGTTTGACTGCTAAATCGTATCGAAATTGTAGTTTCGATAGTCAGCTATAGAAATGCTAAATGTGTTTTTTAAATTGAACTGAAAATTTAAATTCAAGTTCCACATTAGAAAAAATGATATTTTAAAATTAATTTTATAATATGGCACTATCGTAAATTTTATAGCACAGCGAACCTCAATATTTAAGGGCAACGATTTTTTTACGACTAAAACAGTGTAATATATTTGTTATAACATATTTGGTTCATTGCACTGCAGAAATTTCGAATATCAGCTCGAAAATGGAACAAGGATATGGAACAAGAACATTAAATTTGAAACGAAACTTTTTTTTTTTAGCGATTTTTGGGCTCCAAAACGGGCAATCGTGTT


Search Again