CR00681

CRIMIC CR00681

Gene sut1

CG8714

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK79279

Images

Construct Sequences

sgRNA sequence
TGACGCACTAAACCGCTATCAGG

Amplicon 5' Amplicon 3'
CAACAATTGTACCCGCAGCCCAACAGAGTGGAACTGCTCTCGGCGCAGACGGATCCCAGCCAGGTGAGACTCTTTTCCAGGTGAGAGAGAGAGCGGGAAGATCGCCAAATTTTCCCTCTACCTACCACCGCTGTTTTGTGGTTCTTGTTGTTGTTGTTTTCCTGTGGACAGTATCTCTGCACATGCACATTTTCTTTGTTTCTTCTTTCGATCCCGTTGTTTTTCGCTCTCTGTCCGGATGCTGTTTCCCACTCTTTTATCTTACGCATTTTATTTTCAATATTTCGCTCTTTCTTTTGTTTTTATATGTAAATCTACTCGGCTATATGCGTCTCCTCTATGTATTAATTTTATTTTCTGTCATGCATAGTTGTTTTCAAAGTCGAAAAAATATTTATGTGCATGCACACATACAACCGACGCATTAGTATATGGTCGATTCACCTACAGTGGAGCCTACGTTGACACGATATATGTAAACAAGTACATATATATAGTACATGTATATAGAAAAAAAAAATACTTTTATGGATTTTTCAAATATTTCCTATATGCATATATATCCATAAAATTGGGCGCAATTAAGAAGTTACTAATTTCAAATGCCTATGTTAGTGACAAGATACAAGTCACTAGATACGAAGGAAGTTTGATTCTCACTATTCAACTAGATTATATTATGTAACAGTAAGGTGGAGACATGACTTTTTATGTAAATATAATTTAATAGTGTTAGCTTAAAAGCTTTCTATTTTACAACCATGTTTTGTACTGTAACTTTGACCTTTTTGGTACACAAGTACTTAGTACCGCATCGTTTTCATTATTTTGGCAAACAAACTGATTTCCCAGTACATACACTTCGGCTGAGTTCCCAGCCATTGCTTATCAGTTATACAGAAACACCGACTGCGGTCTTCCATTCGGTTATAAATAGTATGCGACCTAATCGCATATGATCCCAAATGCTCCTGCTGAGAAATGGAAAGTTTTGGCCGTGGGTCAAGTTTAGCCGTAATTAGCGCCAATTATTGCGATTATGACAAAGCTGGAATTAATCAGAGAGTGCTGATAACGCAACCCCCATTCGAATTCCGAAATGACCCTGCACAA GGTTCGCATTTTGGGCACAACCAGGGGGAACTATTGCTCCAAAGTAACTAATCGTGATCGGAAAACTTTGCAGAAACCGCGATGGGGCAACCTCCTGCTGCTGGTGGCCCTGGCAACCACATTTGGCGGCGCCGTTTCCACCGGCTACTGCATAGGCGTTATCAACGCCCCCTCGAAGGTGAGATATGGACAACCACAGCGAGTGGAATACCGATTCAAACGATATCTTTACAGCTGATGAAAGTTTGGTGTAATCAGACCCTGCACGACACCTACGGGAGTAACCTCAGCGCAGGCGGTCTAGATCTCTTGTGGTCGTGCGTCGTTTCTGTGTTCCTGGTCGGAGGCGCCATCGGTTCGCTGGGCGGAGCTGGAGCAGCCAATAAATTTGGCAGGTATGTAGCTATTAATCAATTCGATAAGGATAAGCCACTTGGGTTTCCTCAAGTGTTTCTAGTCCGCCAATTCACATATCTGTATAAACCATTCATTTTTGTTTTGTTTTAACTTCCGTTGAACTAAATATATATATTGAAATGAAAATACAAGTCCCTAAGTAATAAATAAATAATTACCTTATCTTTTCCAGGAAAGCATGCTTTCTTATCTGCGGCGCCCTGTTCACCGTGGGAGCGGTGCTATTCTTCTTCTGCCGAGCAGCCAGCTCCGTGGAGATGCTGGTGATCGGAAGGTTTGTTGTGGGCCTTGCCTCCGGCCTCGTGACCGCCACCCTGCCCATGTACTTGTCCGAGGTGGCTCCAATGGCTCTGCGCGGCACTCTGGGAGTCTTCATTGCCGTGGGCGTGACGGGGGGCGTGGTAGTGGGGCAGGTCTGCAGTTTGGCCAATGTCTTCGGTACTGAGGATCTCTGGCACTACGC


Search Again