CR00680

CRIMIC CR00680

Gene gammaSnap1

CG3988

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78982

Images

Construct Sequences

sgRNA sequence
TTGTTGTCGATAGAAGACTTGGG

Amplicon 5' Amplicon 3'
AAAAGTGCACAATGACCGGCCGCTTTTACCACCGAGTCTGAATGCGAGTCCCAAGTGTACGTACCATTTTTCCTGTAGTTTTTCGCTTTCACAATTCTCAAATTGCTGCTTCGCCGAGTATATATTTTACAAATACTGTTTAACCTTCCGCCTTCTTTCACGAACAACCGGACGAATCAATTTGGTCGGTTATTTCGCACAGGTTAGGGTTGCCAGGCGCCGGCAAAGTATCAACATGCGTCGTGACGCGTCGCGACGTTTGTGAAGCGTTTGGAACGGTGAAATGGCACACTTTCGATCTTTCAAAATGTCAAATATTTTAGGGTGCTTTAAAATACATAGTATAGTTTGAGTTAATTTATTTATTTATATTAACAAATTGCACTATACTTTCGTGTAATAAAGCTGAAGATTTACAGATTTGAATCTTAACACATTCGCTGTTTTGGAACATAGAATATATATACATAGTTTACACTTATAGCTACAATTTATTACTTCAATATCAATTCATCCCAAAGCTAATGATATTCTTTGTTGTATAGTATTGATCTTAGTATTTATTAATTAGTACAACGATTGCGATGAAATTTGTATTTAACAGTTAATATAATATGTTAAAAGCGATATTATTAACGATAAATATATTTTGACTAACAAGCAGACCGAACATTAAGAAATTTAGCACAAGCCACCTTCGTCCTCGGCGTCGTTGGTTTCCTGCGAGAGAGAAAGAGAGAAAATACGAAATTCTTGTTAGCTATTTAGTTTACTGCTTCGCACTGTCCCAAGTCTTC ACAAAGGCAGATTCAATCGCCTATCGATAACATCATAATAAGAGCCAAATTTACAAAACAAAAATTGCAAATTCCATTTTTAGAATAAAAATACTCACAGCAGCAGTGTCGCCAGCCTTCTTCTCCATCTGTATACCCTGAGGTAGTGGAATGTTTTTAGATAGAATAGCGTACTCAACATCCATATGTCGTATGAATGGGGATGCCAGCATCCTAGCAGCTAACTCGGGATCCTCGTCATCGAAGGCTTGCAGAAGGGTCTGCAGTGTGGACACTTCCTCTGGCTCGCAGCAGTTTCCCCACTCCCTGAAGGTCTTTTCGGCTTCCACGGAATCCCCGCGAGCCAGTTGGACCATCACCAAGGCCACAACTAGGCGTCCAATTTGTCCGTAAGATTCCGTTTGCTGATTCAAGCTGATCTCCTTTTTGAGCGCATTCGTGGCTTCGTCGTACCTGGAGTGATTGGATGATATAAGCTAAGGATACCCAAAGTGATTCGTTGCAATCATAGGTACATACCTCCTTAGTTTGACCAGTATCCTGGAAACTTTTGATGCATACTCGGCTGCTTGACGGACGGAATCCTCGATCTGTCGGGTAAGTATAAAATTAATAGTTTAAGAATGGAATTGACTAGAGCAGTGTCAAATAGGACGAACCATTATGACTTCTAGAGCATGCTGATAGAAGCGCAAAGCCATGTCAGGATGCTTGGATTCAGTTAACTTGGCGGCTTTATCCAAGGCGGATGCGGCTGCCTCTGGGGAACCGTGCTGTTGATA


Search Again