CR00677

CRIMIC CR00677

Gene Drep4

CG9414

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK80624

Images

Construct Sequences

sgRNA sequence
AACTTTCAGCCCATCTACGTGGG

Amplicon 5' Amplicon 3'
AGTCGGAGCACAAGGAAGTGGACCATTCGTCGAGGATGCAGTTTTCCTTGGTGTACTCCCTAATCACCTGCCTCAGTCTCTTGCTGGGTATCCTGCCAGCGTCTGTTTCCTCGTCGCCCAAGTGCTGCTTCAGGAATTCATGCTTTTGCTTGCAATTCCGGTCAAACATCATGGAGAAAAAGTCGCAACCGATGAGCAGGTATCGAAACTTCTCCAGCACAGAGTTTATCACTTGTCGGGCCTTGGCATTTTGGCGGTACAAGGGATTGCGGGTCAGCTCCTCCTTGGCCTTATAGTAGTAGCCTCGCACACGTGTCTGGGCACGTGTGGCCATAGCTTCCTCCTTAGAGTGGAAGCGCTCCTCGCCGCCCGTGAACCACTCCACGTGCTCGGCCTTTAAGCTGAGGTGGGTCTTGCTGTTATCCAGGACGCGTCGCTGCTTTTGGTGTTCATACTCCGTTATCATGCGGCGGAACTTTTCCGGATGCTGTTCGATAAAATCGTAGAAAATGTCAGCCACCTTTAGCAAAGGCGATTGTTGTCGCATCTTCTCAAACTCAAAATCGGCATCTAATAGAAGACAGATTAATTGTGATTAAGTTAAATATTTAAACTGCAGCTCACCTGTTGTAATGACTGCATCCGGGCCAGACACTATGAACAGCGTCTGGGCGGGTAGGCTTTTTAAGTACTCATCGTCGGACACCTCGAAGCCATCAGAAGCCAAATACAAATGTGGCTCGAGAAGCTAAAAGGTAAAAAAAAAACGATTTAATTGTAATGCCCTTGACATGGCCGAATTATAACGAGGCCAGGTCGCCCAATTCCTGGTTCAGGGGCCTTCAGTTTGTTTCACATTTCTCTTTTTTTTTTTTTGCCAGGCAAGGACGTTCCATCAACAGGTGGTTAGCTCTACTATACAGGACATGCGCATTGGCATTTACTAGTGGCATTGAAAGAGAGCCAAACAAACGCGGAAGCCACTGCCAGGGACATGGCCTTGAAAATTACCAGAGCCAGGAACTTTCAGCCCAT GGTGGGTGTATATTTCGCGCTTTTACGCAGGAGTTTTTCCTGTTTTTTTTTTCTTACCGGGAACTTGCTTTTTGCCTTGGCTATCAGCATTTCCAGGGAATTGGCTCCGATTCCGTATTTCCTCGTTCGCTCGTTGTCAGTAACCTTGTAGCCACGCATTGGAGCACCTGCTGTTCCCCTGGATTCGGATGAGCTCACATCCTTGAGAACTTCGCCTGTTGGCTGGCTGCTTTTCTTGTTATTCGAGCTGCTGCGTGTTGTCGGTGACATGATTGCATCTCTAATGTAGCTGATCATCGTTCTGGCTCATAATAAAGTCAACTTTGGAATGTAGTCCTCGCAGCAAGTTTCCTTATCCGCGGACAAAGCAAAATAAACTAGCAGAACAAGGCATTTTTCGCGCTTCTCAACACTAGATTCTCATTGAAAGATTCTTTAGTTGTGCTGCAATTTTAGCTAAAAATTGCAAAAAGCTATATAATAATAATTTATTTTTTCCCGTGTTTTGTAATTAACGAAATATTTTTTATATTTTTATTAATCAATTCAAATTGATAAAATTTTCATTTATTCTTAAATTAAATAATGTGTAAATTAATAAAATGAAAATAGCCAAATTAATAAAATACAAGTTGAACGGCGCATTTCCCACCACTATTGCCTTCAGTGTTTTGCAGCACTTATGCATCTAAAAACAGCTGTTCGGGTAATCATTTTTTTTGTTAAAAGTTTCTGTGGAAAAACTATAACAAACGTAGTCTTAGTGTACAATGATCTGGGCTACGGGCTCCGCGTAATCCGCAGCTCACCCGGAAAGGCGTTTTACGATGAATCTACGGCCGCGATGCCGCAAGTGGCTGCCCCTAGCCACCCAGCAACTTCGACTGCGGAACCTTAACAGAATTCAGGGATTCAATATTGAGTCCTGGCCGCATGAGAAGTCGCTGGAGCTAGATGATCCGGATGATGTGCTCCTCTACTACACACTACACACGGACAAGGCTAGCGAAGCGTTCTACACCAGCGAAAAGCTGCCGCAGCGTCACCAACAGCAAAAGTGGGCGGAGATTTGTACGGACGACGAGGCCTGGCGGAAAACCAATGCGCAGTGTGTC


Search Again