CR00676

CRIMIC CR00676

Gene CG16865

CG16865

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78981

Images

Construct Sequences

sgRNA sequence
GTAAGTTTGTCAGCTAAAGTTGG

Amplicon 5' Amplicon 3'
GTACAACGAGGAAAAGCCGCTAAACATTTACTACTGTCTGTGCAACAAGATGGCTCTGATTCTGGGTAAGATTACTGGAGCCAACTAACTGAAAGCATAGTACATCATGTTTGCCTATCCTACAGATTGCACCCTCGAACAGTTGCCGCTACGAGAGGTGGACAACGCCCGTGTGATAAACGCCAACGACCATGCCAACAAACTCACCCACAATCCCACACCGAGGATGGTCTACATCAAACGCAAGAGCAGGGGCAATGGGATCGAGAAGCAGTACCGCTACAAGGTGAGTAGCTGACTTCCACTCCTTACCCGTCATTAGTTCACCTAATGTTTTCCTTTAACCTTCAGTGCCGAAGCTGCAGTCTGCCGCTTTACTATCGCCACAGTCCCGACTCCCACGTAACCTTCGTCATGTCCAATGCCCTAATCCGCAACAAGGGTGAGAGTCCTCTCACACAGCTGCTGAATTCGGAGATCAAGGGCAGTTTCAAGGCACCGGCTGCCAAGCCAGCGACTTCCGCCGGTCCAGACGATTCGGGTATTGTGGATGCCAGTGGCAAGAAGGTCGTCGTCACCAGACACACGAAGAACATGGGCAAGTTCAGCTCGGTCACGGTGTCTACCATCGACGAGGAGGAGGATGAAATCGAGGCGGTAAGTTTGTCAGCT GTTGGTTTGTAAATGGTGCAGGAAATCCAATCTATCATTGCATCATCTACGAACAAACCTACAACTCTTTCAAACTAACCATTTTTTTTGTTCATTCAAACAGCGCGAGATCGCAGACAGCTATGCGAACAACGCAAGGATTATCGAGAAGCAACTGCAGCGCAAAGGCGGAAAATTGAGCGATGTGGGCATCAAAACCAAGACAGAGGACGCACCTCCGCCGCAGAAGAAGCAGCGCGGCACGCTACTGGAAAGATAGTCACACTCTGCCTCCTTATTACCCACAACTAAATATATTTGACGACACAAATGGCTGGCATTCTTGGAAGAAAAATTGCAATTTATCTAGTTATAGCATACGCAAATAGTTTGACCTTCTATGCTGTCGTTTTGGCAGCAAACTGGGATGCTGTGCCAGTAGCTTCTTCAGTCGCTGCTCGGCGTGCTGGTGATTGAGAATCGAGTCCTTGACAAGCCCACAACTGGGACATAGATTGTACTCCGACTTTGACTTTTTGACGATCGCTGGACGCACGCGAGTCTCCATGATCAGCTTCATTCGATTCGTGGTACGCGGCGAGTTGTGCAGAGCAGTGAGTGGACGGCACTTACTTCTTGGCGAGGATTCGGTCCGTTCCAAAGCAGCCTTCTCCTTGCTCCTGACCAGCTCGAGTGCACGATTCGCTCGGGCTTTGGCCAGCTGCAATTCGAGAGGCGCCTTTGGCAGGTTAAAAAAGAAGTGGGTCCACTTATCGCGCAACTGT


Search Again