CR00675

CRIMIC CR00675

Gene ckn

CG12424

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK83184

Images

Construct Sequences

sgRNA sequence
GATTAGAGCGACGGGTGGGTAGG

Amplicon 5' Amplicon 3'
TTCGCCCATTTGTTCGAGGATGGAGGATTTCGATTAGCATATGCGGCTTATAGAGTTGCGGTCTTGTTATTATTGTTGTTTTGCTGCGACATTCACTTCGACGGAGTTGTGAGGCATAAATACTACATTAACATACTATTTGAAGTGACATTCCTCGGTGGAGAGTTCTCTAAGTAAACAATTGAACAACGAAGCTCAAGATCAAGAAATATTTTCATACCTACTTAACAAAAGAGTGGTATTAATGGGGGGGTTTTCAAATGGAAAGACATATGACCTATCTAGAAAATGAAGATATGAATTTTATACTTCAAAAATAAATTCGAAAATGATATATGTAATATGTAATATGTAATGTAATAGCACATGCGTTAATTAAATTATCGGTAAGAAAATCTAAGGTAAGGAAAGCAACTAAGTCTGTACTCCACTGATGTCATGTTCAATAGATACTTCTATATGAGACGAACTTTTCTAGCAATCAAATGCTTTCAATGAGATTTTCTCATAGTGAGGCTCTTCCAGCAATCACATTCCATTTCGCAGAAGACAAGGCGTTTAATTAAATTGAAATCAACAGCAATTTAGCTGCCAAAAGAGCAGACAGTCCATAGAGCAAACAAAAAAGAAAAAAAAATGAGGAAAACTGATTAACACATTGCTGCGTACATGGAGCATAATGTGTGTATGTGAAAAAGTGGCTTTACACGCACTGAAAAGCTAACGATTTTTGACTGCATCGCATATGTGTATATATCTGGTGGGGTATATAGCGAGTTTTGGTTACGAGTCGGGCTAGCCTGCTACCGTTTAATGACGACAGCAACGAGTTTTGGCTTTTATTCGTTTCTTTATGCCCGTGCTTTGACGCGATTTATGTCATATCTTATCAATTACAACTGATTAGAGCGACGGGTG TCATGAGAGACACCAGCCCATATATATGTAACCCATTCCATTCCATTCGATTCGATTCGATTCGATTCGTTTTGATTCCCCCCTTTATCAGCGAGGTCTGAACTAGTTCATGGACAATTTGTAGTCTGTGAGGCGATCTGTGTTGTTCCCTACTCTGACATTAATCAAATGCGATTAGCTGGCTTCAATAAAACATAACGATAATGACGTCTCAATTCGAATCTCCCCTCGCATTTCCAGGGATCCATAGAGGAATGGCTGCAGCTGCTGCGTCTGGAGGAGTATATACAGCCCCTGCTGGAGCAGAACTATAAGACGGTGCGCGACGTAACCCAAGTGACTTGGGAGGATCTCGAGGACATTGGCATTGTCAAGCTGGGCCACCAAAAGAAAATTCTGCTGGCCATCAAGCGTGTGAAGGACATAATTAGCGGAAAGTGGAACCCAGGCGGCGCCAATGCCTACCAACAGCAGGTGAGAAGTGGGTGAAAATACAAGGGATTTAGGAAGAAACAACAAGGGTTTTTTAAATTTTACATTACTGCAAACTTCAATCTAAAGCATTTGTTGTATTTTTTCTTTAGTCTTAATTTAATTTGATTTTAATTTACCACTAACTTTCGTTTCGTTTCTATTTTGTTCATTTGTTTTGTATGATTTCCCCTCGTCGGAATGTTGACCAAACAGGAGTACCAGCGGAAGCCCTGGCAATTCAATGTGCCCATACCCAGTACGCCATCC


Search Again