CR00675

CRIMIC CR00675

Gene ckn

CG12424

Information

Donor Location Cytology FBti Stock number
pM37-p02R:14976989..1497700051D6FBti020063083184

PCR Verification

PCR check relative to sgRNA sequence

HA-L HA-R Forward Reverse
OK OK CTAATGATGGCTGCCGCTGCTGTTTA AAGTGCCCACCTTAATGAGCACCACA

Images

Construct Design Sequences

sgRNA sequence GATTAGAGCGACGGGTGGGTAGG
 
Amplicon PCR 5' Left Amplicon PCR 5' Right Amplicon PCR 3' Left Amplicon PCR 3' Right
TTCGCCCATTTGTTCGAGGA CACCCGTCGCTCTAATCAG TCATGAGAGACACCAGCCCA GGATGGCGTACTGGGTATGG
 
Amplicon 5' Amplicon 3'
TTCGCCCATTTGTTCGAGGATGGAGGATTTCGATTAGCATATGCGGCTTATAGAGTTGCGGTCTTGTTATTATTGTTGTTTTGCTGCGACATTCACTTCGACGGAGTTGTGAGGCATAAATACTACATTAACATACTATTTGAAGTGACATTCCTCGGTGGAGAGTTCTCTAAGTAAACAATTGAACAACGAAGCTCAAGATCAAGAAATATTTTCATACCTACTTAACAAAAGAGTGGTATTAATGGGGGGGTTTTCAAATGGAAAGACATATGACCTATCTAGAAAATGAAGATATGAATTTTATACTTCAAAAATAAATTCGAAAATGATATATGTAATATGTAATATGTAATGTAATAGCACATGCGTTAATTAAATTATCGGTAAGAAAATCTAAGGTAAGGAAAGCAACTAAGTCTGTACTCCACTGATGTCATGTTCAATAGATACTTCTATATGAGACGAACTTTTCTAGCAATCAAATGCTTTCAATGAGATTTTCTCATAGTGAGGCTCTTCCAGCAATCACATTCCATTTCGCAGAAGACAAGGCGTTTAATTAAATTGAAATCAACAGCAATTTAGCTGCCAAAAGAGCAGACAGTCCATAGAGCAAACAAAAAAGAAAAAAAAATGAGGAAAACTGATTAACACATTGCTGCGTACATGGAGCATAATGTGTGTATGTGAAAAAGTGGCTTTACACGCACTGAAAAGCTAACGATTTTTGACTGCATCGCATATGTGTATATATCTGGTGGGGTATATAGCGAGTTTTGGTTACGAGTCGGGCTAGCCTGCTACCGTTTAATGACGACAGCAACGAGTTTTGGCTTTTATTCGTTTCTTTATGCCCGTGCTTTGACGCGATTTATGTCATATCTTATCAATTACAACTGATTAGAGCGACGGGTG TCATGAGAGACACCAGCCCATATATATGTAACCCATTCCATTCCATTCGATTCGATTCGATTCGATTCGTTTTGATTCCCCCCTTTATCAGCGAGGTCTGAACTAGTTCATGGACAATTTGTAGTCTGTGAGGCGATCTGTGTTGTTCCCTACTCTGACATTAATCAAATGCGATTAGCTGGCTTCAATAAAACATAACGATAATGACGTCTCAATTCGAATCTCCCCTCGCATTTCCAGGGATCCATAGAGGAATGGCTGCAGCTGCTGCGTCTGGAGGAGTATATACAGCCCCTGCTGGAGCAGAACTATAAGACGGTGCGCGACGTAACCCAAGTGACTTGGGAGGATCTCGAGGACATTGGCATTGTCAAGCTGGGCCACCAAAAGAAAATTCTGCTGGCCATCAAGCGTGTGAAGGACATAATTAGCGGAAAGTGGAACCCAGGCGGCGCCAATGCCTACCAACAGCAGGTGAGAAGTGGGTGAAAATACAAGGGATTTAGGAAGAAACAACAAGGGTTTTTTAAATTTTACATTACTGCAAACTTCAATCTAAAGCATTTGTTGTATTTTTTCTTTAGTCTTAATTTAATTTGATTTTAATTTACCACTAACTTTCGTTTCGTTTCTATTTTGTTCATTTGTTTTGTATGATTTCCCCTCGTCGGAATGTTGACCAAACAGGAGTACCAGCGGAAGCCCTGGCAATTCAATGTGCCCATACCCAGTACGCCATCC
 

Search Again