CR00674

CRIMIC CR00674

Gene CG11807

CG11807

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78980

Images

Construct Sequences

sgRNA sequence
GCATCTATCATTGATGCTCTCGG

Amplicon 5' Amplicon 3'
ACCAAATCTCAGGGAAGCGGAAAGGACTGCGATGGCTTGCTATTACCGCCAGCATGCGGACACCACGGTGACGGTTCCAAAGTTTAGCAACGAGAGTTCCAGCGGCGGAGTGACCTACTACGATATCAAGGTGCGAGTGGGCAAGGTGGAATGGCTGGTGGAGCGCCGTTATCGGGACTTTGCAAATCTTCACGAGAAGCTGGTTGGCGAGATCTCCATCAGTAAGAAGTTGCTGCCGCCGAAGAAGGTACGCCCCCAAACATTTATTACACATACGTATGTAAGTTATGAATAATTTCCTATTTTCAGCTAGTTGGAAACAAGCAGCCCTCCTTTTTGGAGCAACGTCGTGAACAGTTGGAAATTTATCTTCAGGAGCTTCTCATCTACTTCCGTACAGAACTGCCGCGAGCTCTGGCCGAGTTTCTGGACTTTAACAAGTACGACATTATTTATCTGCTACAAGATCTTGCCAAGCTGTTCAATGAAAGCGGTGATGCTCTGCTCAGCTCCAAGAAGGAATACAACCTTTCAGCCCTAGAGGTAAGATATAATTATATGTAAGTGTTTCCTTTGCGTTTTTTGTTAAGTTCGAATATACAGAAAAAATGTCAAAATTATTAGTATTCAACTTTATCCAAACCATCCCTTTGCAGCTTAGAAATAACTTTAAAAGCAAAGTTAAAGCTAGACCCATTAGTTACTCCCTGGGTACCCTCCACAAGCATCACACAAATTTTTCTACAGAGCTGGAAAATACCATAAATTCTGAGAGCAATTTTAAGAATATCAGTAACCTTATAAAGTTTGTTCGACAACATAGTAAGTGGTACCGAGATAATGACTGTATTAATCGACATTATTTTAACTACATATTACTGGATCCTCGAGTAACAAATAATCTAAAAGAACGGGCCAGTCAACTTCACTTAATGGATGTTTGGTATACCTTTCTAAGAGCAATATTTTATGTAGGCAAAGGCAAGGCCACCCGCCCCTACGTTCATTTAAAAAACGCCCAGAAACTGGTAGATGAAACCAACAACATCACATTAGTAAAAGATCCCAAATTGGCGTTAATTGTGTCCATATGGAAGGCAAATCGTGGAGTCTTACTAATACGCGCTTTTCAGGGAATCTCGTCACAAGATGCGCAAACTCGTGAGGCATCTA TGACTAACCGACGATTGGGTTTTTACTATGGTCGAGCTCGAAGTTTATCGGATAAGGAGAGAAAATATCTGGGGATAGCTTTACTTTACAAATTGATGATGAAGTTTCTAGCAAAAGAAGAAAAAGAACTATTTCCTTTAAAGAACACCAAGGCTGCAATGGCAGCTTAAATCAATATAAAATATACTTATACTACTTATTCTAAGATTGTTTTTTATTTTTTCCCCTTTCTACTAGGTCTACGCTATTAGTGAGCGGCTTAGTCTTCCCTGCCCACCGAGCCTGGATCGCGGTGGAAAGTACGACTTCTCGCACGTGCTGGACTTTTGCACACAACTTGTCGCTTTGGTGGTCACCCCGGTCAAGGACAATGCTAGCTATGCCCAGGATTACAATACGGTTGATGTGCCAATCGATCGCAGCAATATTATTCCGAACAGACTAAGTTTTAATCTAAATGCCTTTCGCAATCTCAAGACGCTCAAATTTTCGGCCTTGTCTACCGAAAACATTGTGGACATCGAACTTCTGAAGCCGACTCTCCAGACAATCTGTGTTCATAACACAACCATACAGAACATAAATCAAGTCCTGCTCTGCGACAATCTGCACAAGCACTGCGATGTGCCAAGCCTGCTGCCAGAGACTATCCTTGCATCCCCCTCCGGTTCCGGTCCCTCCACTTCTAATGGTAGTGCCTTGGTCAGTGCGGATGCGTGGCAAGAGATAACAGAACTCGACCTGACAGGCAA


Search Again