CR00672

CRIMIC CR00672

Gene Syngr

CG10808

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78979

Images

Construct Sequences

sgRNA sequence
GTGGGAAAACGGTATAACCGAGG

Amplicon 5' Amplicon 3'
ATGAAACCCATGGAGGCCAGGAACCCGAAGACGCCCACCATGTTGCCATACTTGCAGGCCATGCCGTCGCCATTATAGAGGCAGTACTCCTTGCCATCCTTCTCCGTCCAACCCTCCGAGGATATGCAGCCAAAGACCACCACCGAGAAGAGCTGGAAAAATCAAGAGAATTCCCAATGAATGAGGGCGCCTATTAACATTTAATGGTCCTTTTGTATGCACACAGAAATGTTGAAGAGCTGAAAATGACTCAAAGTGCCATTAAATCAACTATAAAGCTGACCTGTTTTAAAAATTTTAATTTTATCGTTTCAGTTTAATTTCAATCACTTTTGTGTGTTGTGAATGAAAGTACCAGAACGTTGTTATAAAAGTATGAACATCAAAGCTTGTGAACATCCTTTTTACGTGATTGTAGGTTCGAGTTTACTAACACTTTCTGCTGGCTAAGCTCTTACTTAGGTTTTTAATCCAACTTTCGGATTTTGATTTTCACATCATCATTTTCTTATGCTGATATAGAACTCGCACTCCATTATTGATTTTCTTGAGCAGGTGCAACAAACCAGAAGTTCAAGTACACAGACAACGCGGCAGACACGTACTTATGTTTGTGACCCAATTTGCGGAATGAAGGCCAAGTTTGGTTTGTTTGGCCAGGAAGAAAAGAGCGGGAATGGCTCTGCAATCGCAGAGTCCTTGGTCAACAGCGTGGGCACATATTACGTATACCATCGCAAACAGGCGGTGAGCTAAACGCCCCCTCGGTTAT TTTCCCACTTCCCTGCTGACGCACATCCAGTCGATGGCAGAATGAAGTCCTAAGCCTAGTGGCCAATTGCCCGGGCACCTTACCACATTTAATTATAAAGCTTTCATGGACGTGAGAGTTTTTATAGTCCCTCTGCAGCTGAACACCAGAGCACTCCCACTATATCCTCGCTGCGCCCCTCTGCAGCGGGTGTAAACAAATCGGACCTTTGAGTGCCACTGCGTTTATGTGGCAACATTCACGATTTACTTAGATTCTCAAATTACGCACGTTTTCTGCCACATTTACGAGCTAGCCATTTAATCGGAATGGCACATAAAGGTCACTTTTATGGTCGCAATTTAAAAGCAATATTTATAAAAACCTAATTTTATTAAAAGCATTGGGAAAAGAGGGATCTTAAACGTGTTTTTATATTTTCATTCAGTTTGAATTAAGAAAAACTAGATAAGCTAGATATATTTTTAAAAGGCAATATATTCTTGTCATTCTAAATTATTAATTTTTTAAACTTAAGGGTTTGTAAATAAATTAAAGAAAATTCCTTTAATATTTGGATCACAATATTTTAAGCCTTTAGAAGGCATTATAGCAGCACGGAGTTGGC


Search Again