CR00671

CRIMIC CR00671

Gene prel

CG8806

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band80623

Images

Construct Sequences

sgRNA sequence
GATGTTCTGTATGCGTTTCATGG

Amplicon 5' Amplicon 3'
TTTCAGATCAGGGACACGGCGGCTTTCACTTTCGAACACATCGGCGAGTTCATTGGTCCACCTTCAACATGGTCGTGGCAGCATCCACCTGCCGCACGGAGACGGTCTTCGATTACAGCTGGATGAACGTGGTGGTCGCCTACTGGAACCGCTACCCGAATCCCTCAAGCACGCACGTCCTCACCGAGGACACTATTCAGCGGGAGGTGCGCGATGGCAAGCTCTTCTCGCGCCGGCTGCTCTCCAAGACGAATCCGGTGCCGAAGTGGGGAGCTCGCTTCTACAACAATGTGCCGGTCAAGATTGTTGAGGACTCCGTGCTGGACCCGGTTAAAAAGACATTCACCACTTTCACCAGGAACCTGGGAATGACCAAGATAATGGCAAGTGATCGCACACCTACTACGATTGCTTTAAATAGGTCACATATCAATTTAAAGAAATGTCTAGAAGAATTCAGCCACTAGCTGTTGGGCATGACCGAAATACCGGCATAATACAAAAGCATAAGTGTTACCTAACAGATCGATGGTCAATGCTGTGGCATTGTTTGTTATATTTAACCCATGAAACGCATACAGAACATCGGG AACGCATACAGAACATCGGGATCCGGTTAAGATTATTGTTCGATTTATTTTACTGCACCCTTTTAGTGAATATGTGAAATATGTTACTTAATCTTTTCAAGTTTAATTTAATCCTAATTAATGATCATTGTTTTTTCCTTTTAGAAAGTCGATGAAATTGTCGTCTACAGCGAGCAGAAGGATGGTAGTACTCTGGCGGTGCGAAGAGCATACATTAGTTCGCAGGTGTTCGGATTCTCGCGGGCCATTCGCGCCTTCGGCATCGAACGGTTTAAGGCCAATGGCAACAAGGCCTCCAATGGATTCAACTACGTGCTGCGGCGCATGTTTCCGGACAGTTTGGTTGGTGGAGGACATCACCAGCACGCGGTGACGACGACTTCGCCAGCTGGAGAACTTCCTGCAACGACCATCACCGTATCCACAACAAACGGCAGTCTCAACAACCAAGGAGCTCTCAAGAGCGCCGCAAAAGTGGGCTACGAGTTCTTCAAGAGTCATGCCTCCAAGATTGCGCAACTGTTTTCTGTCAAGAACTGAGGAACTTCTAGTCTGTACTTTTTGGAATAGATGTCGAATGGGACCGAAGATTTTAATGCTTTCGGCTCCGGGAGTTAAGGAGTTTGTGGATTTGACCAGGACGGAATTAGAATGACGAGCGGAGGAGTCGTGTCGCCGGGTGTTTTTAAACATTTATTCCAAAGCAAATCCAACTACATACTTTGCTGCATTTCATTCCGTGTGTGCGCGAATCAAACGGCTGATCTGAACGGAG


Search Again