CR00670

CRIMIC CR00670

Gene CG14591

CG14591

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78978

Images

Construct Sequences

sgRNA sequence
TGCTTAAGGGTAGGGTGTATAGG

Amplicon 5' Amplicon 3'
GGCATGGTGTACTCTGCTGTAAGGGACGCCATTTCCCCTGCGTCATGCGGATGTCCATCGTCCACCGCTTCCTGGTTGCTAAATCGGTGTCGCAATATCGCCTCCTCCTGCATGGCATAGTCACCTTGGGTTAATTGGTGATACTGGGCAGCCTCGCCCCTCGGCTCCGGCATACTTCCCGATCCGGTCAGGCCGCTGCTGCTCCGATTCCGGCGTCCGAACAGCACCACTGTGCCCTTACTCAGCAGCGGACAGAGCAGTGCTTGGTGGCAGCACGCAAATATCCGGTAATTCGAGCCCTGGAACGGATCTGACATAGCCGCACAGAGCATGTGGTCCAGATTGATACCAGTAAACTGCAAAGAAGGGAAGGTATTAGTGGCAGGAGACGTTTTGGATGAAATACATAATGTGCTAAATATTGTAAATAATGAATTTAAGTATACCAGAAAATGCCATCGTTTCAATTGTTTAGGCCTCGAAAAATCTGACCAAATAATGCTAGAATTTATTTACTGGCGTTTTCCTATACACCCT ACCCTACCCTTAAGCATAGATGTAAAACACTTTTGCTCGAAACGAATGTAGAGAGTAATTTTAAGTTTAACGCCACTTACAATTGAGAGCGGAGAGAGAAGGATGAAGTGATAAAACAGCATGAAGGCGGTACCTATATGTGACCAGTGGAACTCGCTGAGGTCCTCGACAGTGTACGCTCCTGAAAGAGAAAACAAGATTACTTTTCCGACCAAATAGATGGCGTCTCCTAGTTACCGCTTCGGATAATGTAAATCGGTATTATATAGAGCAGTGCATGCTGGATCCAATAGGTGGCCTGCTCGAAGGGATATGTGCGGCCCTCCACCTCGGGGAAAAGAAACGCCAGAAATGGGCCGTTGAGATTGCTCATCTGTATACGAAAGAGCGCTGTTGTCGTCTTCGTCGGCTTGGCGGCCAAAAGATAAATCTGTAAATATCCCATGTATTTTTAATTGTTCTACGACAATCCACATGACAAATTGTTAACCTGCAGGCATGACTGG


Search Again