CR00669

CRIMIC CR00669

Gene CG1416

CG1416

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80622

Images

Construct Sequences

sgRNA sequence
AGGAGGAAGCGTTATATTTGAGG

Amplicon 5' Amplicon 3'
TGACCCGCTTAGTGATCCTGATTAACAATATACGATATAATTTTCAAAGAATGTAGTACTCCTTATCAGTCAATAAATAACGCGTATAAGACCATATTCCTACGGGCCTCTAAATTCGAAATATTTACAAAATTTTATGTGCACAAAGAAAATAGTAATATGAAAAAAAAATAACTTTGTGATTTGTCTATTTATTATTTATTGGTTAAGAAAAAAATTAAATTCGTTACAATACGTCGGATTTAAACTTATGAATGTAATGATTTTGGTTTAGTACATTTTTGAAATTTACATTCAGGTTAAATTCCTATTAATACCTAATTACATTATATGATGGAAACCAGCAAATTTGGTTAAAAACGATGTAAAAGCTCGAATCTAATCTAAAAATAAATTCCTGAAGTAAGGGTTCTGCGAAATAGGATGAAACGGATAAAAAACTCTGTATGCCCGTAGAGAAATATGGTCTAGTAGATTCGTTGAAGAATATTTAACAGGATGAAGTGAACTTTTCCGACGCTATATGTATTATTGATCAGTATCAGTAGCCAAATCTATCTAGCCTTGTCTGTCCTTATGAATTTTGAAAAAAGTTTTGAATTTTTTTCGTGTTATTATTTGCCGTTCCAATTTCTATCGAACGTCAAATATATATAATTAGGAAATGTACTTTATTTACCTCTTACTAGTAAATTTAATGGACGATGTTCGTTTGTCAGCCGTCTTTTCGGAGGCAATGCAGCATATTCATCTTTACCTATCTCATTTTTAAAATATATTATTAATACTCCCAGAGTGACGACCACACAATTTGTACTTAATTTATTTCTTTATAGTCGGGGAACTCTATTATAGCGTTCTTCCTTGTTTAATTTTAAGTTTTGCGATCCTTCCTTAAGCTTAATTTTCCTGACTTGACTATAACCAATAAGGATTTTTTTGTATGCCTGTTTTTTTTTTTTTAATTTGTAAGCGTTACTCGCTATACATTCGGAGAATGATGCTTTCAGTGCTATCCCA CTCCTTGCAGTCATCCAGCACAATGATGTCGCTCAAGCAGACCGGGATACCCGCGTCCGAATTTGATGCGATGAAGACAAACTGGTACCGATATTACTGGCATAGCATCAAACAGACCTTTGGATTCGGTACCTCAATATCTGATGCCTTATAAGAGGACGCTTCTAGTGCGGATTGCACTGAATGATTGAGGGCTTGGTGTATGGCGGATTATCGAAGGATTATTATTTGTATTCAACCTAGAGTACTGCGAGAATTTCATTTCCAATCATAACTGTAATTTCTGTTTATCCTTAGAGGCTTTTTCAAATCCTCTTAGGTATATCGATCGAACTGGAAAGTCCGCGGCTCGCTAAAAAAACACATTACTTACAAAAAATCGAATACAATTCAGGCATTCGACATTGATTTCACACATTGAGAAACAATAAACAATAATTTAAAACAAAATGTTTATAATTTTGAATTGAATATTAATAATAAATTTGTTATATTATTAAGGACATAAAAAGCTTTAAAAGCCTGAAATTTAAAAAGTTATATTTTTATGATTTCCGATTTTCATACCATTTCTTACTCCGAAGGGGAAAGCATG


Search Again