CR00668

CRIMIC CR00668

Gene Rchy1

CG16947

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80621

Images

Construct Sequences

sgRNA sequence
TTGTCTTGATCGCTCGCGTTTGG

Amplicon 5' Amplicon 3'
GCTGCTGCTGCGATGATAACACTCGAAGTACAGAACCGAACCGGAGAAGAGTCTTCGAATCCGGTTTCTTTGTCATTCCCCCCGGCTTTCATTGCTGTGCTTCACTAACGATCGTATTTTAATGATCGTTTGCATCTGCAATTGGCTAACTCCAGACATCTCAAATTTATTTAGCCAAGACGAAACAAAGCTTCTAACACAAATTGATACAAGATTCGCGGGAACAGGCGATATCCATGGGGCATTGCTCCACTTGGGGGATTGCACATACTGCTCTCAGCTTATGTCCACATTCATGTATACATTTATTTCACGCACTGTCGGGCGAAAATAAATATTTGACTATAAAATAACCCAGCTGATTCAACACTCAATGGGCACCTCATTAGTGCACAAAACCCTCGCTTATCCGAATTTCTCGCGGTGCACAGACGAAAGCAAAAACCTCTACATTCGAATTTTATTAAAATGTGGGACAGATTGAAGCGTGTGTACGGATTTACGTGACATTTTTTGGAAAGTATTGTAAGGCCATAGCGCATAATACAGAATTTTTGGGGAATTAATAATTCATATCGCGAATTGGCTGCTTTTCAACAACAAATAAGCGCTCACTACTGTTGGAATTATAAGTATTTAAATATTTACATTTAACTTTCTTTTTCTTTATTTAATAATCCAGGTCATTCACAAACAAATCTATCTAATCAAGTGCAGCTGCAGTCTTCTCTGCATGAGATACTTTATACATGAAATGGTTACCACTTTCCCCAGCACTGAGTTACTTTTCCCACCTTCGAACTTCTGTACTTATCACCTTACGATAATTATGTCTGCTGGCTCTACTAATTGTTAAGGTAAAGAACCTGAATATAGCCGTGCTACGATTGCTTTATATGCACACACAACATTTTTAGATGCCCCATAATTTGTTATCCAAACGCGAGCGATCA CGAGCGATCAAGACAAACGCATTGTTTGCCCAGATGAATGGCGAATGGAGGTGTTAACTGGCCAGTGGCCACTCGCCTCCTGCTCAGTTCCTGCTCAGCGGAGCATGCTGACCAGTTAGTTTTTTGGATGCCGGACATCGTCAAGCTGTCCACACAAGCCAAACACTTGCCGTGCAAATAGCGATGCCCTCCAATTGAATTCAAAATCTAGTCAGCAGACAGACACAAAAGAATCTTCGCCAAAGGTGTCTGTTTAGAGTTTAGCCACTTTATTTGTTTAGGAACGAATAAATAAAGGTTAAATGCGCCCATTTTCAGGAAGGTAGCTGTGTTGGATAGACACACACACACACATAGATAGATAGATGGATAAATAGGCATACAAATGCCATTTAGAGGCGCCATCATAATCTTCTTGAAAATTTTCCAAATGGGTGAAATGTTTAATGGCTTTATCACTTTGAATTTATTTCAATGTATTTTTAGGATTCATTTTATAAAAGTGAAATGACTGATCCGCTTTCTAATCATGACATAGGGGTTCCAATTGCATAATTCTTTATCTGATGACCCAGGAATTGAACTATACCCGTATAAAATAAAAAAAGAACTTTCAAAATTGAAGTTTGTTCTTATATCACATAAGTTGACTGGTTTCACATTTGAGGTTTGAATAAACTAATCTCACTACAAGTAAGACTGCTAGATACATGGATCCGTCTAGTCTTTCTACGAACATCTATCTACTAATCTTAAGAATGGTTATAGATACTACGATACACTAAAAAAGGATTAAAATTTGTATTGATATACATATCAAAGAAGTTCAAGTGTATAACTTTTATAACTTTTCTGGGGCTTTTCCTTTTATGTAATGCTTGGAAAAGCATCCATAGATAATATGAATGGAGTTGGACTGCCTGTTG


Search Again