CR00667

CRIMIC CR00667

Gene TM9SF2

CG9318

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OKOrder from Bellen Lab

Images

Construct Sequences

sgRNA sequence
CGCAGTAACTAGTTATATGTGGG

Amplicon 5' Amplicon 3'
GCTCCTCGCCCAAACAAAAGTCGAAGTGATGGTACTCATAGGGTATTACGGATTCCTCAGTGTTTAAGCGGTTGACGTACAACAAGATTTCCGACTGAAGAAGATAATCAGGAATTAGATCAATCAATTGGATTGACAACTGTTGATAATACTAGTGTATTTTAATCTTATCGTGGAAATAATTATTAAAGTTTGGTAAAAATTCCAAAAGTTTGCAAATGCGTTCGATAATTTGACCCCGTAATTTGCTTTTACTTTGGGTTCTTAGAAATTTATCTTATCAAAAAGCTCTCTTAGATTGTTAGAAACAATTGAATGTGAAACACCTTAATTAATTCTTATCATTGGGCAACGTCTAATTTAAGGGCGTATAAACCGATTAGGATTTCTTGACCTACGGGTATATTAAAAAGTTGTTTAGATTTGTTTAAAGATAAGATGAAGCAAACAAAACCAATAGCTCACGCTTTATCATCCAATAGTTAGGTCATCTTTTAAAAGGGCTAACCCCATCTATTTGGGATATCAAACTAAAAATTATACTTTGTCCTGAATTTATATTGTTATTGTGTTATACTATTATTACTAAAAAGAAAATAACCCAAACATAATGCAAGGAAGCATGACAAGCTAACCGCGTTCCCTGGTTCAATTATTGGTTAGCCGCCACTATGTTAAGATTCTTAAGGTCGGGAGCCCCCGAAATCGCATTCGCGAGCCAGCTGAACCAACATTAGAACTCCCATCTAGCTGTCGCTAGGAAAGAGAGCTGGCGTAGGCAACGTCAGCAGAAGTTGAGATAGAGGGCCACATATGGACCCCAC TATCAGTGCTTCCGCCTGTGACCACCATTAGAGGAATATAGAACCAATGTACATAACTAGTTCCAGTGCCTTTGCTAATTGTGGCGGGCGTGGGGCAAACACACCCACTATCTACGTACATATGTACATCTGCACTTCTGCACATACGTATACACCTACCTTGCATGTGGATGAGACGTCGGTTTTCTTGCAGAAATTGACCGGTGCCAGTCCGGGCAGATAGAAGGCCTGTGTCGGGGTCGCAAGGTGCAAGAGAACGACGCCCAGGAGCGGCAGAAGTCCGGATAGCAGGATCATCTCGAATTGGGGTAACCAACGAACGGCAGGAGTAGCAGACCTTCTTCCTTTACTTGTACGGGTTGTAATCACAACGTGGCCGTGTCCGCGATTCTCTGCCACACTTTCCGGATCGGCGGGCCACGCACAAACCGTACTATCTGGATATTTATCGGAATATACGGAGTTTTTCGAGTGTTTTTACTACGTTTCCTCTTTTTTGCCGAACGTCAGCACTGTAGCAGCGTTGCCACCTAGTACAGCT


Search Again