CR00666

CRIMIC CR00666

Gene CG8635

CG8635

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78977

Images

Construct Sequences

sgRNA sequence
CACATCACGGATTTACAAAGAGG

Amplicon 5' Amplicon 3'
GGCATTATCGTCGTCGTCCTCCCTGTTGTAGACGTCGAAAGCAGCGTCGCCCTCCTCCATGGGTCCGTCGTCGACCAGATCCGGATTGAAGCTGAACATTTCGCGACCAGAGATGCCGAACTGTTTGCCCTTGCTGAAGTCACTCTTCTTGCGCTCTTCCTCGGCAGCCAGCTTGGCCTTCTTCTCGGCAATCTTGCGCTTCTTCCAGGCGAGGAAGGACTCGAGGGTGACGCGTGTCTGGTTGGGACCGAGGGCAGCGCGCTCCTTCTCAATTAAATCGACCAGCGAGATTTCCGTGGGCTTTTCCTCCTTCTTCTTATCGCGCTTCAGCACATATCCAGCTGGCAAGGCGTGACGGTAGATGCACTTTCCGCCGTTGGGGCACTCCCAGAACCAGCCGTACTTTGATTTTTCCACAGCTTCCAGGAAGAATTTGCAAATCTGAAACACAGGGGAGGTTAGTTTTGAGTTTTAAGCAGTTTTTTAAACTTAGACCCACAATATCCGTGGTGGGACGTTGCTTTTCGCCGGAGCTCTTCTTCTCGACCACCTCCTTCAGCTTGGCATCGTCCCAGTTGGTCATCGGATCGTCCTCGTCGCGCATGTCCACATAAATGGACCGCTTTTCGACCTTGTTCTCCTGGGAAAGATCGTGGGAGAACTTGCACTTGTCGCCCTTGGTGCAGGTGCCCTGTTTGAAGAAGGCGCAGACCACCGACTTGGGATCGGTGCCCTTCTCCACCTTCTGAGTCTGTACCGGCTTGAAGATCAGCGCCATCTCGCGCTGTTCGGCCAGCTTCTTCTCCTTCTCCTCCTTGCGCTTGTCGCCATCCTGGCGAGGATGCTGTCCGCCGGACTGGACCTGCTTCTGCACCTGCTGGATGAACTTCTGCTGCTTGTTGCCCTTCTTGTTCTTCAGCCCGAAGGTTTTGTCCTGCCGATGGAATTACACTTGGTCAGTTCAATGTGGATCTTATTGAATTTCTCCCTGCCGGGTTTCCACATCACGGAT GGCTTTCCGGTTACGAAGCCTACCTCAATGACTTTCTCCTTCTTTTTCTGCTCCGTCTTCTTGCTGGGACCTGGTGGCGCCTTTTTGGGTGGCATCTTCGGGCGGGATACGGGAATTTAATAACTTAAATGTAGAAATAAAGTTCAAACGAAGTTTTTTGCACAACCACGCTGGAACAAGAGGCCCTGTCAGTGTGACCAGAGTGCGGATGGCAGCATATCTCAGGAAGAACCGGTTATCATTAATTAATTTAACAATTGTGCTTTTAAAAATGTAGTAACTGAACAAATGATTTCTTGGCCAGCAACTTTTAATTAATAAGTGGAGTGTGCATGAATTGCACACTTTTAAACTGTGTGGTTTGAAAAAGAGCTAAGGTTTTCAGCGCACACTTAAACCACTCAATCGATGTTTACATGGGTTCAAAACTTGGCTATTTAACTTATTTCTAATATTTAATATCATACATTTTAAATCATCGTTTGAGTTACAACTTTTAAAAGACATATCGTTAAACATATATAGTAAGTGGCTGTTTCAGCAGCATAGCGACTATTTTACAGATTTTACACGAGCTCCATCTAATGGCGTCGACATTACTTAGAATACTAATGCCCTACAAGTTACCTATAATTTATATCCGATCTATAGAGCGATTCGAATAATTTTTGGTATTGGAATCTAGCTGCTTACTCCCATCTCATTAGCTGATATAACTGATATACAGGCGAAGGGAAAGACGGACATGGCCGGATCGACCTAGGTAAGGGTAAGGATCCTGGTCCAGAATATATATACTGTTCCTGTGACTTAGCATTGAAAAAATCTTGTATATATAGTATTCCCATTAAAATACCTTAAACCCTCTTCTAATATAAATCCCATCTTCCATTGCTCAAAATTGATACTTTTTTTTCTCACTGTACCATCTCGCTCACCAACACACATGCAGCAACGAGAAAGAGAGCAACGACGTGTCTCTTCGTGGGTGGCCCTTAATTCGACGTCATCTTCTTGGGTGGTCCATATTAGCCGGCCTGCTCTCTCCCCCCTTTTGATCTCAAGTGCGAGCGAGT


Search Again