CR00664

CRIMIC CR00664

Gene mRpL24

CG8849

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band short band80620

Images

Construct Sequences

sgRNA sequence
GGCTCACGTAACACATCGCATGG

Amplicon 5' Amplicon 3'
CCGGGATGGGTATGATTCGGCCAGATCGCAAGGACACCCGCACTTTCTCGCCCTCCTCCGTGAAACGCCACTCAAAGTCGGTGCCCTGAAGATCCGATGGGTCAACCAGACGAATGTCCTTGGTGACGTGCAAAGGTGCCTCGGACTTGATAATGATACCGGGAAACTCCTTCTCACCGCCAACCTTGCGATAGTGCCAGTTCAGGCCCTCTACAATTACCCAATTGCGCTCGGGTATAACCTGGGTGACAATTCCCTGCTTTCCTTTGTCTTTACCCACAAGGACTTCGATACGATCGCCGCGGAAAAAGCTCCAGTCCTCTGAAAAGGATATACAACCATGTTTTATTAGGTTTTAGAGGTCAAGGCTTCTTATTCCTTACCAATTGGTTCCACTAGCACCTTGCGACGCACGGTTCCGGGCATATTTTGCTGGCGGAACTGACCCGTCCATGAACGATTTGTGGTGTAGCGGAATCTCTTTCGCTCCACGGTACGCGGTAGGTAATTAATCTCCTTCGGAGTTTGCCAGTACACCTGTGTTGAGATGAAAAAAAATATTTTAATAAATGTGAAACATTTTCCATGCGATGTGTTACGTGAGCCGCT GAGCCGCTGTTCACAAGTTGTTCAATGAAAAAGACTCTTCCTGTTACCTGTTTTTTGCTGCGCTCGATGTATTCCTTGGGCAGATTGGAAAAGTTCTTCAACTTGCTGGCCAAATATTGCGTTAAACGCATTTTGAAAGGTTAATTCAATTATTAATAATAAGAACTAGTAAATTAAATGCGGCTTGCAATCAGCTGTTGAGAACTGAAGAATAGCCATTCACAGGAAGGCCCAACAATTTTATTTATATTTAATGTTTATGCGACTCTAAAGATTATGAACACTTGATGTAGGCTTGTAAAATATTTAAATTAATTATTTTCGAGGTTTAAGAAAATATCTTAGCTTATATATTGTTAAACATTATGATATAGAAATTTAAGAACTAGCAATTATTTCCCCGTGTAAACGTGGTTCGCTGTGACTGGCAAGAAGAGGTAAGAAGAAGCAGCTGCTATTTGTGGACTACTCTTGGTGTTTTATATCGTTCGCCGTAGCCCTAAATTGCAATGCAAACCGGCTTTATATAAACAAAAGGTAAGTGCTAGACCATATAAATGTGGGCACGTGCGGGCGCAACATCATTGGAAGACGGAATCGCAACCGGAGAGCGTCTATTCCGGCCAGCTCAGTCCAACCGTTTGGGAAGGGCCTTTCAACGCTTAGTCATATCCATATCTCAGCGCACACCGAG


Search Again