CR00662

CRIMIC CR00662

Gene GABA-B-R3

CG3022

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78976

Images

Construct Sequences

sgRNA sequence
GTGAGAATGTCATTTCTACGTGG

Amplicon 5' Amplicon 3'
GCGCATAATTCAACCGGTCCAAGGGACCAGATACGGTCCATGGCCGGCCGTGGGACTGAGGCTAGTCCTGGCCCTTGCCTGGGCAACGTCGGCAGCGGCTGCCATGGAGTCATCAGCCGAGCTGCAGGCCCTGGGCTACGAGGCAATTAGGCCAGGTGCTGCCTCAATTAGCACATCCAGCCCATCCAGCTCGCCACCCGGAGAATCGGCATCGACTGTGACTGCAGGGGGGACTCCGATTCCACCGCGCTCCGATTGGAAGTACAAACGGACGAAAGTCAAACGCCGGCAGCAGCGCCTCAATTCGCACAGCAATCTGCCCGGAAGCACCAATGCCTCCCACGCCCACCACCTCCTCAATCTGCCCCCCAGGCAGCGATACTTGAAGGTCAACCAGGTGTTCGAAAGCGAACGCCGCATGTCGCCGGCCGAAATGCAGCGCAATCATGGCAAAATCGTGCTGCTCGGACTCTTTGAGCTGTCCACATCGCGGGGACCACGTCCGGATGGTCTGAGCGAATTGGGAGCTGCCACCATGGCCGTGGAGCACATCAACCGCAAGCGCCTGCTGCCGGGCTACACCCTCGAGCTCGTGACCAACGATACTCAGGTGA TAACCGTATGCCCCACGTTGGGCGCCACTTCTAGGCGTCGCTGTTCCATTACGAAATTGAATTTTCATTCAGTAGCGCGTGCAACATTAAAACTTAATAAGAAAATCTGCAACAACAAGAACAGTGCGGATAGCAGCTGCGGCTGTGGCCCTAAAAGAGAGGCAAATATGTCATCAACCTTCCGTCTTTCGCGCTTTTATTGCGATGAGTCGTTGCCGGTTTTGATGGGGCACGCAAATGTACAGAACACTGTCACTGAAGAAAAGCAATGCCACTGACTAAGTTACCAACAATGTAAACTATTTACCTGCAATCATTTTTAACTTGGTGCAGTAGTGTATTAAAGCTACAATTAATTGATGGTAAAAAAAAGAAAATGCATAATAGTAGTTTAGTTTCTGATAAATTAAACCGTCAATACGTAATACCTCGACTGTGATGTCAGCACTTAGTGAACTAGGTTTTCAAACGATTTTTTTAAGTGTATGCATATGCACATCGACCTTAAACAGACTGTCATATCTGGAGCCGCATCTCCGGCTGTGCCTCTCTAAAAGTCGACATTTTAAAAATGTTTATTGCGCCATCATGTTGCCTTTTTATTGCGTCGAAACGAGTCAGCGAGCAACGGCCTCTGCCACTGCTATTTTCCCTGCCCCCTCTATTACTCATCTCTGATGTGGTGTCCTTTGCTCCTCCGTTTCTTCACACATTTCTTCTCCGACAATCAGTGTGATCCTGGAGTGGGCGTGGATCGCTTCTTCCACGCCATCTACACACAGCCCTCGACGAGGATGGTGATGCTGCTGGGATCGGCCTGCTCGGAGGTCACCGAGAGCCTGGCGAAGGTGGTGCCCTACTGGAACATCGTGCAGGTGAGTCATCTGCGACTGATTAAAATGCAAATAATCCAGCTCGCTCGGTTC


Search Again