CR00660

CRIMIC CR00660

Gene alpha-Catr

CG2987

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78975

Images

Construct Sequences

sgRNA sequence
ATAATCGCTGAGGACTAGAACGG

Amplicon 5' Amplicon 3'
ACAAGCATCGAATCCAGGCACTCGCATCCGCATCGAATCCCACAGGAGGCGTTTGACGAGAAACTGTTGCACTTTACAGTACTAAATGGTTTTGTGCGCAGACTTGCTGCGCAGACCAATTTGTTACAAGCTCGAATCACACACAAATCTGGGGGCATACACATATATCTGTCTGCAGGTAAACACGTTGTTTACAGCCACCCAGCTATATAACACTAATTTGAGCTGAGGAGCTTTCGCTGGCTGAAAAATCGACTTTTATTTGAGCTTAAACCCATAGAGCCTCGTACTATGACGCGCTAATCGGTGACCGTATTATTGAGTGCCAAATTCTCGACTTAGTTGCAATGTCTACTCGACTCTGCTAGCCCTAGTATTGAGAAAAATCAATAGGAAGTAAATAAAAATGCTGCATGCCTGAAACTCGCTTTGCGGATACTCTTAAACTACGTATAATCAATTTTTCTATCGGTAACCGAGCTATCCAAAATGTACGGAATCACTCAATCAACTGTTAACGTAAGTACCCAACCGGCTGTCCGGGATAACTTTCCGTTCTAGTCCTCAGCGA TTGGCCTTGAAACCCAACCAACTGCCAATGTGGGCTCTCCTTCCCCTCTCCAGAATCAACGCTTTCGAGTTCGTGATATGGATAACGAGCAGATCATGTCCACTTTTGGGAACATAGGTCACCTGCTGAACATTGCCGTGGAGCGATTTATAACCATTGGCGAGATCATCGCCGAGGAGAATATTGACATCAAGGGAGACATGTACGAGGCGGCGAAGGAGGCCAGAGATGCGGGTAAGAAGACATCCTTTCCAGCCTGGTACATCCTTTTCATTGTATTTTGTTGTACGATAGGAAAATCGATTGAACGACTTTGTGATATTTCACCTCTAAGCGGCATGGAGCTGCGCCACCACATCGAGCCCCTTAAGGACTATGGAGCCATCATTTTGGCGGCCCGCTCCCTGCTGTCGTCCGTCACGCGCATCCTACTGCTGGTCGACATCATAGTTGTGAAGAAGCTGCTGACCGCCAAGAAGCGGGCCTCCGAGAGCCTGGAGAAGCTGGAGTCGGTCATGAACTTCACGGAATTCGTGCGCGCCTTCTCCGTGTTCGGAACCGAGATGATTGAGCTGGCCTACCTCACGGGCCACCACCGCAACTCCTTCAAGGAGGAGCGACGGCGGGCGCAGATGTTCTCGGCCCGCCAGATACTGGAGAAGTCCATCGCCATCCTGTTGACGTCCTCGAAGAACAGCCTGATCCACAGCGACTGCGTGATCGTGAAGGAGAACCGGGACACTGTGTTCTGCCAGATCCG


Search Again