CR00658

CRIMIC CR00658

Gene CCT8

CG8258

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 short band OK80619

Images

Construct Sequences

sgRNA sequence
TTAGTCATCCTCATGGAACGGGG

Amplicon 5' Amplicon 3'
GACGGGGCAGGAGAAAATCACGATCTTGGCCTTCTCTGCATAGGTCACATCGCCTTCTACGAAGCGCTTGAAGACCATGCCGCGAACCACCTCAGACTTGGTCAGTCCGCTGCCCAAGATCTTACAGATGCGAATGTTGTCCACGTTGAAGGTGCCCTCATCCGGCAAGATGGAGACGCAGGCCTTGCTCACCAAATCGTTGAGGAAGTCCTCCTGGCCGTACTGCTTCGACATGATCGATGTGCGGAGTACCTCCTTGACCTTCTCCACATTGCGATAGTCCTCGATCTTGTGGCTCACCAGATTGGGCAGAATCTCCAGAGCCTTCTCCAAGGCCTTTTCATAGCCGTCGGAGATCTCGGCAGTGGTGATTCCTAGACGCAGCAGCTCCTCAGCGGACTCCAACAGAGCTCCGGCCAGCACCACCACGAAGTTTGTACCATCGCCCACCTCGGCATCCTGCATCTGGCTGGCCATGACGATCAACTTGGCGGCTGGATGCTCAACATCCAGCTCCCGCATGATGGTGCCGGCATCGCTGGTCACGAACTGCTTCTCGATGTGATTGATGATCATCTTGTTCATGCCATTTGGCCCATAGGCAGAGCGCATGGTCTGTGCAAACTCCTTGCAGGCGCTGATGTTGCGGAACACCGCCTCCTCCAGCCCACTGTACATCTGAGGACACAAGTAAAGCCATTAAATTAGTCATTTTTCTTTCATATGTCGAGCCCCGTTCCATGAGGATGAC ATGACTAATCACGCGCCTCCGCAAGACGGCATGTTTTCTTTTAAGCCGAATCTCAATGAAACCGATGCCCGGCGGACTCCTCGCAGAGTTATTCCTCCTTGTTGCACTTACCCGGGCGCCATCCTTCAGCATCTGCGACACACCGGGAGCCTTGGGAACGGATAAAGCCATTTTTTAACACAGATTTCAATTTCACACGGAGTCAGTCGGTAAATTCCAGCTATAGTTATAACCTCAAAGTGGCCGCGAACATTCTGGATGGGATAGCGATGGCACTTGCCTATCGATTATCGTAAACGGTGACTGGCGCTATTTTATTTTTATTTTACATTTGAATTGATCTTTTTCAATAAGGTAACGATTCTCAATGGTTTATGATGAATAGCATGCAATTAACAATATAGTTCAGCAGTGGAGTTTACGCCCCAAAGAATCCTGTAAATCGAGTTTATTTCTTGGTCTTTGAACGCATTTACTTAAATAATCCAGGATAATGTATATAAGTTACTCCAAATAAGTAATATTTACAGTTGCAAAAGAATTTACTCATTTTAAGTTTTGAGGAAATTTTAAAACAATTAGAGTAAAATATTTTATTATTTAATTTAAAAACTGAAAAGTTTATTTAAAAAATTCACATTCCCATTGGTTTATTATATTGTTCACTCGATGAATTTTGTTTGCATATAATTTGATAAATCTTTCAAGGGTATAGGAAACGTCGGTAAATGCAATTCAATCGTGAGTCGTGCGTGACATTTGCGTGATAGATTGCATTAAGTGCGACGAGTGTGAGCCGATGTAAACACTAGCCTTAGCGCCCATCTCTAATTCAAAACATAAAAAACGATGTCGCTGGGCAAGAAGCACGTGTTGGGATTTTCGCCCAATGGTGGCCAACTATTTGCCTCGGTGGACGAGTCGGGAGTTCTGCGGATATGGAACACAGAGACGAACACGCTGTATCAGGAGTTTACGCCCAATCTACAGTTATCCGGGTCGTGCACAGCTCTCACGTGGGTTTTGGTGGCCGGTTCCCGGCCCAAGAAGTCGCGGAAGAGCCTCCAGGCACAGGATGCAGCCGGTGATCAGCTTCACATTGCTCTGGGAACGTACAAGGGCTCAGTGG


Search Again