CR00657

CRIMIC CR00657

Gene CG6805

CG6805

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78974

Images

Construct Sequences

sgRNA sequence
AAAATCAAATGAACTTTATATGG

Amplicon 5' Amplicon 3'
CGGACTCTCTGAGCGATCACCAGTTCGTAAAGGTGGACTCGAAGCAGCTGCAGGGAATTCTTATAACCATGTTCGCACAGCACAAGCACATCCCGCACATGAAAGAAATCGAGACAGAAGCCACGCGCACGGGACTTGGAGGGCTGTGGGGCAACAAGGGTGCCGTAAGCATTCGACTTTCGCTCTACGGAACTGGCGTCGCATTCGTCTGCTCCCATCTGGCGGCGCACGATGAGAAGCTGAAGGAGCGCATCGAAGACTATCACCAAATCGTGGACAATCACAAGTACAATGCGCAGGGATATCGCCGGATATTCGATCACGACTTTGTCTTTTGGTTTGGCGATCTTAACTTCCGTCTCTCCGGCGATATGTCCGCTTGGGATGTCCGCACGGATGTGGAGAACCAGCGATACGCTGATCTGCTCAAGCTCGACCAGTTGAATCTGCTCCGGGAGAAGGGAAACGCCTTCAGCTTGCTGGAGGAGCAGCAGCCCAACTTTGCGCCCACTTTTAAGGTAACAATCTAATATACAATCTTATTATCTCTACAGTCAAAGTTTGCCTTGAACTTTCTAATCTTAATCTAAATAATGTATATAGGGGTGGGTGTAATTAATTTTATCTGCACTTGAATTTTTAATTTCCGCCAATCACTTCATCAATCAATCACTTCATTCGGCTCCACAGATTTCATGAGAAAAGCAAAATCCAACTAATTTATGAGGCAATATGTCGAATGTAATTAATTCGCCTTATCTCTAGCACCCA TTGCAGTTCGTGGAAGGCACTAATGACTACAACTTGAAGCGGCGACCCGCCTGGTGCGATCGGATTTTGCATCGCGTGCAGAGCAACATTTATCCGGGCATTACCCTGAGTGCCAACCAGCTGTCTTATCAGTCCCACATGGACTACACTCTCTCCGACCACAAGCCCGTATCGGCGACATTCAACTACAAGGTCGAGGCTGCCAACCAGACCTACACCGACGAGGAGCTCCACGAAATGACGCACGGATCTGCCTCATCTCCGGCGACGCCAAATGTTAGTCTATCCTTCGCATTTGTTGTTTTTGTAGCTGTGTCCTATACTCAACTTTGATTTCGCTTCTTTTGTAGTTATTTATCGCTGAACTAGAGCAATGGTAGCGCCGTCATGACGTCACTTAGTTGTGAACTTTTAAATCTCTTTGCATGCTTTTAGATTATATGCGTAGACGAGTTGTAGAGTAATTAAAAGACTTCCTTTCAGAAGGAACAAGAGAAACGAAAATAATATCAAGTACAATGTGATGAAATCTCTGCTAATTTAGCAATCATTTAAGCAATTCTCAAGTGATCCATGGAAATAATGCAGCTTCCGAGTATATATACATACATATGTTATCACTCAATTAAGACGATATTAATTTAACGATTGATTGCATTAAACAAATGTATTTTTGTACACTAAACTGTTGATCGAATAAAAAAAACTATTACCTCTCGACGTGACTAATCTTTTTTGTTACTGAGTCAATTAAAATGATACTCTGTTAAGTATTTGTATTGAGAAACCTGTTAATACAAAAAAATAAATAAATCGATATGACGCATTTTTGTTTTGTTATTGGAGTAACTTTCCCAGATAACAACGGATAAGACTTCTTAGAATGGTTTTGGGTTTATTCGATGCTGATGACAGCATTTTCGTTTCTTTTATTAGCTATTAATGTTCCTTGGGTCGAACAGTTCTTTATACAACATTCGCCTGGGCA


Search Again