CR00656

CRIMIC CR00656

Gene E2f2

CG1071

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78973

Images

Construct Sequences

sgRNA sequence
GCTCTTTAAACTAGCTTTCGAGG

Amplicon 5' Amplicon 3'
TCGCAAATACCTTCGTCGCTTTTTAACGCAAAGTTGAAGTCTTCCTGCGGAGGATTCAGCTGCAGCAGCGGCGGGTTTTCTGCAACATCGGACAGCATCAAGTTAAACAGGGGGTCTTTTAAATTGGCAAGATAAGAAGACAAACCTAGATTCGGATCATCGGGATAAAATCGCCGCAGCGAATGACCGGACAGATAATTTTGGAAGATTATCTTGGCCGTCAGCTCGTTCTCCAAAAGTTTCATCTCATCTTTCATCCCGGGATTGCACGAGTAACCGTGCTCGTCGGTGATCACGTTCCCCGCGCATGCTGGAGCGTTACCATCCTCGCTGGAGTGCGACGACGTCGAGGGTGAGGGCGTGTCCAGACGGTGATAGTCAAAGAACCCATCCACATCGTGCGGATTTGTAGTACTCTTTCCTTGGTTCGTCACCAGGCGAATGTCAATTGCGCTGCCATTGTCCAGCGACACGGCCAGCTCGTACTACAAAAACAATGTTTCGTTTGAATCCCATATTATACGATAAATTTAGATATTTCTTCGTTGAAAGAAATGGGAAACCTCGAAAGCTAGT AAGAGCTCCGACTGGTAAGATACCTACATGATTACGCTTGATATCTACTTCCTCGTCATAATTAGGTATTGTGAATACGGAATCATCTCCAAAGATGTCCAGCAGATCATCACGTGTCACATATGCATACGACCTATTCGAGGGATCCTGCATAACGTAGCGCAGATTGCGCTGTGCATACTCCAGTTGCCTGTCTAGGTCATCCTCCAACATTTTCAAATGATTAGTCCGGCTACGTGCCAGGTCGTAGTTCTCTTGGTCCTTGGCATTGTTAAAGCCCCCTCCGCTGGAAAATGCACATTATCAATAATTTATCAAGAAATATTTATGTGGAATCATACTTTGAAGATGATCAAAGTAAATTCCACCTGTTTGTACTGTATTAAGTATTAAGTGCTAAAGGGCGACTTCCACCCCATTTTGTTTAATTTTGTTGTCACTAACATTTTTAGTTCTAACTAAAATGTTTCATAAAATGTAAGGGGCTCTTACCGCCAGCGCACTAGGGAGCAGTGTCTGCCCTTATCAATTAGTCCAATGCCCTCTAAAACATTGGTAATATCGTATATTCGGCGCTTCTGTACGTCCAAGATTTTGGTTGCCTGCAGAGGGGAAATTTGGACGATGTTAAGGTAGAGTACTTAATGCTTGGCCGTGTTAGTACCGCTTTCAGGTCGATGGATCCTTCGTTGGCCTTCACGAGATCCACAAACTTCTGTGTGAGCAGGACCAGTGAGCCCACGGAGCGCTGTTGTCCAGGCTGCGATTGCGATTGTGAATTCGACGGAGACTTGATTGGCGTTGGAGGATCCGGTGATGTGTCCATGCTAACGGGTGTAGACTCGTAGCTCTGCGACCGGACCGAAGTCTCAGCCGAATCCACCTTCATCATCATAGCCGAGGAGGTGGTGCCCGCTGCGGAGCTGTCTCTTTTAACAATACTCGCGGTTTTGCGCTTGTACATGGTCCGCAATCGACTCGATGACTATACTCCTGTCCTTGTAACTCTTTGCGTGGCTGCACTCAATATGCAGCGATCAAGAAGCCGGAATTAATTGCACTTTGGAGCGAAAATTAAACGAAAATACGAATGTTGGCGCTAGGTTTGCTTTCCGCCATTTATGTCATTTTTTTCATTCTCCCTCTATTCTTCGTGCGCACTGC


Search Again