CR00654

CRIMIC CR00654

Gene Mapmodulin

CG5784

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK no band80618

Images

Construct Sequences

sgRNA sequence
CGTCGTGACATATTGATAATTGG

Amplicon 5' Amplicon 3'
CCTCGCAGTCTGGTCACATTTGTAACATTTTTTGACGCAAAGCGAACAGAAAAAAAAAATGGAGAACAATACATACGCAAAAATCGATCAAACGCTGAGAAATTTTTTTTTGTTGAAATGCAAAACGAAATTACATGCAAAATAACCAATTTGGCGTTAATGCAAATGACTTGGTAAACATTGCTGCTGCTCCATCGCCAAATTGCATATTTTTGTAATGCAGGCGACGAGGAAAAAGTGCCAACTCGCGTTTATGTAACCCCAATATATGTGTGTGTGCCACAAGCGTGTGTATGTGTGCGTGTGCTTCGACACAAAGCAGAATGCGCAAAGAGAAGAATGACGAGCAAAACGGAATTATCAAGAAGTGGAAGGGAGATGGCAGGGGAACAACAAGACTAGCCGGCACTCGCAGCAACAAAACAACAACAACATGGTTGACCGTGACGTAGTTTAGTTGTTGCGCCTGTCTGCGAATAGTGGGTGGGGGTGAGAGTGGGTGGTGTTTTGTGGTCTGATAATCTACAAATGAATAAATGTACACAACGTACGCCTTTTGGAGGCTGTGCAAGTTCA ACGACGCCACAACAAAACCAACAACAAAGAAACAAAATGGGTGCCTTCAGAGTCCGTCTGTCCGTCTCTGTCTAGCCGAGAAACAGTTATGTGCTTACAGCGGACACTTTCTAACCTGAATTATGGTTCAAATTTATTTTATTTCTAAGTGGCAAGAATCTTGGTATATCCTAAAAGAAAATTAACTGTAGCTCAACACAATTTTTAATAATTATCAACAAAATTGAATATGAAAATATAAAATTGTAAATAAAAACTGACTGCAAAACCTAATCTGTATTCGGTTTGATATACTTTGTAATATAAATAACTTATTGTTTGATGAACTTCAAAATCATGTTTTTGGTAATGGAATCAATTTAACTATGTTAAGAATCTTTTTATGGATATGGTGTAGTTTAAACAAAAAATTTAACTCTTGGAAAGGAAACAAAGTGGCACTTCCCCAAAGGTATAATTTATAAAAATTGGAAATGAAAAAAATGTTCGTATGAAATTCACGGCTAAGAATTCGGTTGTGCTCGATCTATTGATCGATCTAGTAAGCACCAAAGTGGGGAATGCAAATGATCTAAAATATAGCTAACAGTAGAGAGTGTCTACTGTATTTGAGCAAATGAGTGGAAATGAATGCACACAGCGTTTGG


Search Again