CR00651

CRIMIC CR00651

Gene botv

CG15110

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band no band80617

Images

Construct Sequences

sgRNA sequence
ATACCGGTTTCTCCGTCATTCGG

Amplicon 5' Amplicon 3'
GCTTTCACTTTCAAGGCCCGGCCCACAAAAGCAGGCCCAAAGCAAAGAAAAGAATCAATGGGCGGGCAAAAGAAAGTGAAAATGTCACCGACAGTAAATATAAATAGAGGCTTTTACCCATATTCGAGTATTCCGTGCAGGATTCCGGCGAATGATCGATGTAACTTTGCGAGTATAATTAAAATCCGGAATCGGTTTTGTGCACTTAGGAACTATTTTCGTTTCCAATTAAAACTCGAACACAAGTGGTTAGAAATTGGCAGTCATTTCGCGACTATTAATAATCGGTTCAAGTGTTTTGCCGGTAATTACAAAAACAAACTATTTGAAACTATAAACCGCGAGGCGAAGCGGACGCACCGCGGATTTGGATGCGACTAAAATCACAAACACACTTTTGTCACGACAACTTAAAAATCCGACTGTTACGAGCTTTGAATCCGCTGTTAAATGAAAACTGTTGATTCGCTGTTGCGAATAATTCTGTTAGCAAGTGTAAGCAAAAACTTCATTGGTTTTTTGATTCAATTTTAATTATTTGATAGCGCTAGCAGTGAAAACTAAGATTACTAAGCAAGAAATACAAAACATTTGCTTTTATGGCTTCAAGATTGAAACTGTTATGTTTGAATAATTCGATTTTGGCGGGCTAACCGATGCCTTTGATAATTATCGATGCACCGATTACACGCATACTCCAAGTGGTGGTTGTGCAGCCCTGCATCGCGTTGCCAACGAAACGGACTCCACTCGCGATAAAGTGTAAATAAATGAGATATTTTGGTGGAATCGCGAGCTGAAACTAATGCCATGCCACCGGCGTACGACCTTGGCCATTCCGGAGAGGCGTACCAACCCCTGGACACTGGCAGCGGCGGCGGAAACGAAGCCTGTGCCCCGAACTCATCCTCCGCGCAAATCCGCCATTCGATGGGATTCCGGACATCCTGGATGCGGCAGTTCCGCCGCTACAAACTGCCCATGGTGCTGCTGATGCTGCTGTTTCTCGTTTCCTGCCTAGCATACCGCATCCTAAGCGTAGGTATACCGGTTTCTCC CGGATACCGGAAGTGAACTTCAGTGGAGATGGGAACTCAAATATTTGGAGCACCAAATATATTTATCTTATAATTAAAGATAACACTTAAAAGTAAAACAAAACAAAACACTTGTTGAATCAATAATAATCTTTATATATTGTTCTTACATTCAGATGTTTCTAAATATTTGAGTTTTCTTTATATATACGTGTATGTAGGTCAAGCTGTAAAACACAAATACAATCATTTATAAGATTCAAATTTAATCTATCATTGCTTTTATATAATTGAAATATTGTAAATATGTCCGATCTCAGATACTCACACAAGAACTACAAACTTTTTGCTTATCTTCTAACGTTATCAGCGTGTGTCAAAGATATTTACTTACCATAGATAATATTCTAAATATTGATCAACTGACAACTTTCATATTTTCCAGGTGGAGCAAGATGCCCCGCCACTGGATCTGCATCGTAGTTCACCGCTGCTAGATGCCTACGAAGATTTCAGCGCCATGAGAGCAGGAGATCTGAAAATGCGCATCGAGGAGATGGTTAGAATCAAGGTTAGTAGCCGAGAACTCCTATAAATACGTAGCCAGAAGCTCAAACCTCTTCTCATCCAGAGCACCGTGTCCGTGGAGTTGCGCGAATTGGAGTCCCGTCGCCAGAAGCTGCAATCGGACATTAGCCAGTACAACCAGAAGATCGAGGAGCTCAAACAGGAACTGCTTAGGGAGCAAACAGAACTGGAGCGCCTCAAGATCTCCGTGGAGCAGGCTCAGGTGGCCCAGCGGGAGGCTGTTCAGCGGAATACACCGGACTTGGCCTTGCCCCGCTCTCTTTTACCCAACACACTGCCAAGAAAGAGTAATCCCATCACCGGAGGGATGGCGGCCAGCTGCGAAATGCACAACTGCTTCAATCACTCACGCTGCAGTCTAACCTCCGGATTTCCTGTTTATCTATACGATCCGGATGAGCATAGCGTTCAGCGAAAGG


Search Again