CR00649

CRIMIC CR00649

Gene CG4945

CG4945

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK short band83182

Images

Construct Sequences

sgRNA sequence
TTTCCCGGGGAAGAGACAATTGG

Amplicon 5' Amplicon 3'
AGAGGCAAGCGGGCATTATTTTTAATTTAGCTGTTGATATTATGCATAAAGCGAAGAGAGAAAACAAACATCAAAACAGAATAGAATCAGCGAAGCCGGGAGAGTGCCGAGAAGAATTCTACGGCCTGGTTCTGAAATCTTTTTTCCTCAAATTCCGACCGTGTGTGTACGTGTCAAAATATTTATACGCGCACACGCTCCACGGATTATTTGTTTGGTGAATTTCCACCAGGCACAGTCTGCATATATCTATCTACATATGTCCGTTTACCAGGAAGCGAATATACAAATCCCAATTCAGCCGATCAATTAATCTCTTAATTTACTTTAGCCGCGTGCAGGAACAGCAACAAAAGATACATCCATTAATGCAGATACTAGCGCGTATAAAATAAAGGAATCGCACAGATATAGAAATGTTTTCCTTTGGTGTTTCTGCTGCTGTTTCTGCTGCTGTCGCTATAAATATTTACAACGCCCGCCTTGTATACAAAGTGTAAATATGTAGATACAATCTGCTAGATACATTCGCGTACATAAACTGTTTCAATTGTTTTATTGGCCCGCTCATGGACAAAGCTGCGCAGAATTGAAAGTGAATCAAGTGCTATGAACCAGTCCAGTAAATAAAAAACTGACTTGCAACCACATAAACAGCCAAAATGTCTAAGAAACCACGTGGAAACATTCACAAGATACGAGAGTTCGAATTGGAGAAGGTGAGTGATCGGATATGATTCAATCCGAAATCGAATTGTAATACTCATTCATTTCCGCGCGACTTGTGACCCATTATTTTTATTTTTTTTATGGTTTACCGCGCCGCCATAAACAAATATGCAGATAGAGAAAGGTATTAAGAGTTCGTCTTGGCCCAGTCGGTATGATGGGCAATCTGCCAATTGTCTCTTCCCCGGGAAATCG GTCTCTTCCCCGGGAAATCGTCTACAATACAACTGGGAAAATGCCATGTTAACGATTAGATTTCTGATCATTAAACACAAACAGCAATGGTCAGCGTCTCGTTCTCGAATACAGTAATGTTTAATAGGTCTAGGTAACGCATTCTATACATACATATATGTAGTATATAGTTGCCCAGTGCATTTGCACATTTAATTGTTCAGATATAGTTGAGGTGGGTCTTTAACGAGGCGTTGCACTTCGCAAGAAGCTCTCTTTGATTTTTTCGCATAAAAGGCAAATGTATTAGTGAGTCAATTAGTTCGTTAATAATGGAATTCTGTTTATGAACACGTGTTGCATTCTAAATCTAAATGAAAACAGCAAGTGGTGCAAATCAAGTATATATACTTTGAGTTCCAGAACATGAGGTTCAAACTTTTTAAAGGCATTAACTTTGGTGTAACTTCTACATAACCTATTTTTAGTTTAAGTTTTAACAAAATATGTGCCCACCAATATTCTCTATTTCAATTTAAAGATATTATGGTTCCATGAAGTTTTTCTATCCCCATTGAATACATCTATGCATATATCGCAGCTGTTTTAATATGCCATCTATATATAGATCCAGCTTGTGGACGAGTTTGATATCATACAGATCGTTGGCGAAGGATGGTTCGGGAAGATTCTACTGGTGGAGCATCGGGGATCACAGACGGAGATGGTCCTGAAAGCTGTACCCAAACCATATGTGACATTGCGTGACTTTTACCGGGAATTCCACTATGGACTCCACTTGGGAGTCCATCGACACATTGTGACCACCTACGACGTG


Search Again