CR00646

CRIMIC CR00646

Gene alpha-Est2

CG2505

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OK80616

Images

Construct Sequences

sgRNA sequence
GGACAAAGAACAAGGTCCGAAGG

Amplicon 5' Amplicon 3'
CTGCCTCGAGATACAATCGGAATCAGTATCACGGAAACTTTGACCAATCCAACAAACTCGGAAAAAGTTCTTCGAATTTCAAAACCACAAGAACACATATAACATCCGAATTGCACTAAGTGGAATGGATAGCAATTATGACCAAATAACACGTAAATCGAGGCAAAAAGTGCATTGGTGTGCTACCTATCAAAAGAAGTTTAGTTGACATTTTATGCAGCTTTGAGCATTCGGTTTAAGTTTATTTGATCAAATTCAAAGTTATGCCGCAGCTTCAAGAAATTTTATATTCGTGTAATAGCCTTTTGAAAATTCATAATTAATTGAGGCTATTTCAGCTACACTACCGATTAAATAAGCCAGATGGAGTTTTTCGCTATCTGATTTTGTTGAAATGAATCTTCGTCTTCTAACTCTTTTACAAACTTTGTATATATAAAATATCAAATAAATAGGTTGTTTAAATTATTAGCTACTCCATTGAAAATCTCACTAGTTTTTTAATAATTTTTTTTTTTAATTTACTTTTACAAATAATTCAAAATATATATTTCAAATGCATGTATTATTAGCTTACAATGTACAATTTCCTTTATAATTAATGCGCACTATCTTTTACAGTGGAGGACCACGTTATACTTTCACAAATTAAAAATATGTTAAATTATTTTATTAACTTTTATATATTTTATATATATATATAATATATATATATATATATATTTTATGCATGTAATTATTATTATTCGCTGCCAATAAGATATGTCTATCATTTGAAGTATGTATGTTGTCAGGCAGTTACCTATTTTGCTGACCTATGGTGTGCTTGATAATGATCATCCGGCAAAATACTTTTGAGTATTAAAATGTAATCAAATGCTGTCGGCGTCTCTCCTGATTTAAGGTGCTATCACCGAATTTCTCCGATTAGTCGCACGGCATTATTCGCTCGGACCAGAAATACAGCGAAGCCCTCGAAACAAAATATTAGTAGATCCCGAATATAATCCTAGCAAATAGAAAAGAACCAAATCATGGAGGTGCAAGTGGGATGGCCAAAGCTGATCAAGATGGGAGCCCAGTGAGTAATTAGATTACAGGCCAAGAGTGCATGGTCAATGTCGTGATTATTGGC GGACCTTGTTCTTTGTCCCCAATCAGTCAGTCTGTCTACTATTATCCCCGATCTGATTCAATCTCTCACTCAGGTTGGTTGGCCACAAGGTGCAACAGTACCGGCTCTCCACGGGTCACACAGTGATTTTGGACACCAAGTACGGACAGGTGCGCGGACTCCAAAGGAAGACGGTCTACGACAAGGAGCCGTACTTTGCCTTCGAGGGCATTCCGTACGCCAAGCCCCCCGTGGGTGACCTCCGATTCAGGGCTCCTCAGCCACCGGAACCCTGGCAAGGAGTGCTCAACTGCACTACCAATCGATCCAAGCCCATGCAGAGGAACATGCTCCTGGGAATTGTCGAGGGCAGTGAGGATTGTTTGCATTTGAACGTTTATGTCAAAGCCTTGAAGTCGGAAAAACCGCTGCCCGTAATTGTGTGGATTTACGGAGGTGGTTTCCAAAAGGGTGAGGCCTCCAGGGATATTTACAGTCCGGATTACTTCATGAAGAAGCCAGTGGTATTCGTCGCTATCAACTACAGGTTGGCAGCACTAGGTAAGGAATCAATTTCCATACAAACAAAAGCCGGAAAATTAAAGTATTAAATATGACAGAAATATATGTATGTAAGTCTATTGGACTAATGTACACAGTACTTGTAGTTATTGTATTCGAATGAGAGAAATAGCACATTTTTGATAAGGCGCCTAATCATTCGCATGTAAACTAGGAATAGAAGAAAATGTTCCTACAATATATATACTTTTTATAAGCATTGACAATAACCAATTTTATTAATTTAATAGGTAAGAATAAAAGTATACAAAATTATTCCTATTACGGTATGTTCTAAGAAACATACTAAAGTGGTCAATACACATTTTTTTAACATCTTATAATAAAATATAAAATAAAATATTTATGTAACCTGTCTTCCTTTCAGGATTTCTCAGTCTAAAGGACCCGAAGCTGGATGTTCCTGGCAATGCGGGACTTAAGGACCAAGTAATGGCTCTGCGTTGGATAAGTCAGAACATCGCCCACTTCAATGGCGACCCCAACAACATCACATTGATGGGAGAAAGTGCAGGATCGGCT


Search Again