CR00643

CRIMIC CR00643

Gene fzr

CG3000

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK short band80615

Images

Construct Sequences

sgRNA sequence
CAACCTATGAATTTCCCGCCTGG

Amplicon 5' Amplicon 3'
TGCCACCTCTAACCGGAAACTAATTAAGTTTCAACGCTGAAAATAATGACCAACTCGACGACTGTGTTTCTCCATTTTTCTGTTTCCTACCAACTCTTCTCCTCGACTCGTCCGCTGAACTCTCACGTCGGTTTGGGCCTTGTCGTTGAACCCATGTTGCCACACAAGAGTTCAGATTTCCCCGTTTTCCCATGAAGTTTTTGGTTAATGTCGCTTTTTTTCGCTTCTTTAACTCATTTCGTGTTTGATTTCTACGCGGAACTCATTAGCGAATGAAGCAGAAATACGCAAGTTCTTTCGTTATGATTACATTTATTTTAAATTAGTTTAAACAATAATATAGATAGAAAATAGAATGCAGTTCAAATATTTCAATCCTATCAATTGACACCGTCGTAGGTGCACAGTTTTTCCACTATTATAATATCATGTAAATTATCGCTGGCCATGCTTGTTTGTTTGTTGCTACACTTTGTTTATTTGTTTGTTGCTACTTCTGCCCGCCGGCGGACATGGGAGCACCGTTACCTA TAGGTTGCTGCTGTTCGTTCTTTGCTTTCGCCAGCGGAAGAGATGACGTAGCAAAAAAATAAAAAAAAATAAAAAAATAACGGCTCGTGCAGAGTTCAATGCACCCAAACAAAGTTACAAAGTTACAGAAACCATTCTATCATTTGAAAATTTGGTAACCAACTCACCTGCAGGGTATGAAGCGGTCGAGAGATGTGGGCGTAGTGGACGACTCGAAGTTGTTGAACAGATTCCGTGCCACAGGACTGTAGTGCTTCAGGATGCGCTTCTCGTACTCGGGACTAAACATCTTAAGCGCCTTTGGCTGGCAAAAACTCAACACAAACTCAAATGTAACCAAACAAAACTTGCAAAAAAAAAAATATAAACACTCAAAAAAAAAAAAATAATACGTCTTTAGTTTTAATTTAAAACTTAAAAAGTCTGGTTAACGTGGCGTAGAAAATATATATATATATAAATGTACACACAATTTATGTACGAGGGCTGCAAGAGAGCAAAAAAAAAAGCAGATAAAAATAATTAATTAGAATGGTTGCTCTATGTATTGCGGTGTTGTTTTTCGAATTTGAATAAAATTGTAATTTATTTGTGCTGTTTTTCGACGGACTACAGCGACATTTTGGTGGCCCCAAAAGCCATTAATCAACGTCTGGAATTGAATTTGGCCTTTTGGGCTCTGTGCTTTGGGCCTGGCTAATCAACCCGACAATTGCCTTTCTATTTCGCCCCCCTACTTCTTTTTCGCACCCATTTCGTTTTGGGGGCGTATCAATCACGGCTTAGAATAGAATAAATGGCGGCTATGTTGGGAAGAGACAGCGG


Search Again