CR00642

CRIMIC CR00642

Gene sens-2

CG31632

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK80614

Images

Construct Sequences

sgRNA sequence
TACTGGACAACAGTAGTCGGGGG

Amplicon 5' Amplicon 3'
ATGGGCGTCACATGAACCTTTGGACGCAGAAATCACACCGACTCATCGACTCGATCACAGTCTAATTTTAAAAACAGTTTAGGCATCTAGAAATTGTAGTGACTACACCTAAGTAATGGGTTCTTTAGGTTTTCCTTAAAAACTGCTGGATGAAAAGTGAAAACCGTCGGCTGGCCGGGACAAGCAATTAAATGAAATTTATCAGCGAAAGGAAAAAGGTAAAAAATTGTAGTCTAAAGTTTAGATAGCCTCCTGATTTATTGCCCAGCGATAAGCAGCTGGGAAAAGGGTGCAATATACGGAGCAGGGGTTTGGGGCACAGCCATTCTGTTTTGGTGGGGGGGGAGTAGCAGGCATGTGGGGTGAACACCTCTGATTGATTTGCAGTGTAAAAATAAATAATATAATTGCAATTGGCGACATTCGCGTAGGGGCTTCAAAGCAACGCTGCCGACGGAGCGACAGACCAATACAGCTGATAGCTGATGGCCGATGGCTGATGGCTGATAACTGGTATACACACATTTGGCCAACTGTTGAGTGTTTGGATACGCAATCCCCATCTAATGCCACTCAACGAGTGGAGCTTATGCGGACTAAAGAGCTCTGAGAGGTCTGCTCTCCCACCAACTGATATGCTATCGCTGGGGTGGGCGATCCAAATCCAAATCGGAAACCCAATCGGAATCCAAATCGAAATCCCAATCGGAATCCCAATCGAAATCCAAATGGAAATCCAAATCGAAATCCGAACAACCCAAGTCGAAATCGAAATCTCAACTCAATCCGTAAATCATGCACACACATTCGCCAGGCATGCCAGCGAACAGACCAAATCATGGCCTAATCTATCTAACCGTTCACAGTTTATGGCCCTCTTCTGGCCATATCGCCGTGGCTCTTTATTATTTATACTGTGCTGTTTTTATTTTTCGCCATTTCCACTTTCATATTTGCCGAAAGCGGAATTTGTTTTTTATAATATTACGACCGGCCAGACC CTGTTGTCCAGTACTCCGCCCTCGATTTAATCGAATCGATACCTGCGAAATATAAAACACTTGGACTCCACTCCGGCGCCCGAACCAACTGATTTTGTGGCCACAAGAGGTGTTATAAATTACGGCCAAAATGAGAATATGTTTGAAAGCCAAATTAGCGGCACATGCCCTGAATTTTAATACAAAATCTATATGTCAAAATCCATAGAAAGTCTCACTGATTAGGAGGTAGTGTAATCAACGTTTTTGGTTTTCGTAGGACTCAAGATTTGCATAAGCCAAATCCTGACGTCCTATAATTACATAAATGATGATGTTTCTTAATTAAAATTATATGCGTAGAATTGCTCGCTTAACATAAAGAACCAAGTATTTCCAAAATGTTTACTAAACAATTTTTATAACAATCCACACCCCCCCCCCCTCAAATTTCGGTAGTTCGCGAGTAATTATAATTGAAATTCCAGAAATTAACACCTCCGGTAGGAGCACCAGCTGCCCTCCGGCAAAGCGTAAACCCAAACCAAATTGTAATGGCTGCAAATCGCCCCAAAACAATAATCATCCGTGTGGGCGGGGTAGACAGTAAACAGGGCGCAGGATAACAATGATTTCAATTACCATGCAGTGTCGAATAATTATTTTACCTTCGTCCTTTTTATGCGAACAAGTGCGTGGAGTGCGTGAATATTGCTCCCGGGCGGATAAAAACAGATGAACGTCAGAGGCCGAAGGGCTGCATGATATTGGGTGTTAGGGGGTTGGGTGTTCCGTGTATCCTGGGTGTCCTGGTTGTTTGGGGTGGACGAGGGCTATGTCTATGTCTAATGTGCACAAATTTATGACTTTGCTGCCGACCGTCGAGGGGTCGTTGATGCCACTTTGCCAGCCTCCAGCAGCCGAAGGACACACCAGGACTCGCCAGGACTCGAGGAGGAATCGCCACCCTGGAGCGACATCGGGCACATGCTTAAGCTCATTATTATCGTTTAAACAAGTCGCTCTACGTGCGCCACCAGGAGCCACTTGTCGTGGCTCTCCTTATCCTGGTTGTAATACTGGTCCTTGGGGTTGCTTTTGGCCCACTAGTCAGCAG


Search Again