CR00641

CRIMIC CR00641

Gene IscU

CG9836

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK80613

Images

Construct Sequences

sgRNA sequence
CTGAAAGACAGCGTTTCAGGCGG

Amplicon 5' Amplicon 3'
AACCACCATTCACTGTATCCATACCATTTGACTCACCACTCACAGAGCTCTAGCGAACAATAATCGCATACTACGACCTAATGCCAAGTAATATATAGTATATGGTATTGTATTGTATGGTAGAGTACTTATAGTTGTTTTTTTTTTAGTAGTTGTTCAGAGAAACGCTCCACTACATTCACAGATTCCGTTCCGCCTCTCAGTTGGCCACCTTCTTCTGCTGCTTGACCTTGTAGTCAGCCAGGGCCGCCTTGATGGCATCCTCGGCCAGCATGGAGCAATGCAGCTTGACGGGCGGCAGACGCAGCTCCTTGGCGATGTCCGTATTCTTCAGCTTTCCGGCCTCGTCGATGGACTTGCCCTTCACCCACTCGGTGGCCAGGGAGCTGCTGGCAATGGCCGATCCACAGCCGAAGGTCTTGAACTTGGCGTCCACTATCTTGCCGTTCTCGTCCACCTTGATCTGCAGTTTCATCACATCGCCGCAGGCTGGTGCTCCGACCAAGCCGGTGCCCACAGTGACATCCTTCTTGTCCAAAGATCCCACGTTGCGCGGGTTTTCGTAGTGCTCAACGACCTGTGGGTGAAAATAGGTAGGTGTGTTAGTCACCAGGGGGTTGTGCTATCGCGCTTATCACTTTG CTGTCTTTCAGAACGACAACAAAGTCGTTTCTTATCTATATTATACAGCTTCTAGATATTACGAAAGAACCTTCCGCGCGGCAATTGCGAGTTCTAACTTACATTTTCATGATACAATGCCACCGGGACACTTTGTACGCGCTTCAGCTGCGATCGCAGCAACCGGGAGGAGTTTCGCACCAGGGACATATTTAAATTAAATAAATCAATTTAATGAAGAATTGTTGTGAAATTCAAAGAGATCGAAAAAACACAGGCAACTGCGTGTTAGAAACAGCTGATGGACAGTGTGCCCGTTTTAAGGCAGATGTGAAAGACCAGCTAACGCCGTTGTCGATATGTTTTCGATTTTTTAAAAGATTTCTTATATTATTATTATTTACTCCTTAAAAACAGTTCAGTATAATAAGTTATTTACTATAAGTAATAAATTGTTTTTATCAATAATGAGCCATAAAAAAGCTTGAATAAAGCACCCTCTTGCATTTAAAATCACACTCTGAGTTGGCAGCTTGCCAGGTATTTTGTAAACTCACTCCTATGGTCACTCCCCAATCACAAAGTTTACTATTGCCCATCCACAAATTCTGCCAACTTCCGATATATTTTTACAGCAGCAGACTATGAGTTTCTGAAACTAGTCCCCTAGGTCAATAATATCCACATCCAGTCATGACCTCTCGCAAGCGCAGTGGCAGCGGCTCCACCAAGCGGCCCAAGGAGAAGGTTCGCCCGGAGCACTGGATTTCACGAGCTCCGCCCTCGAAGATTTGTGCTTTGCTTGACTAATTGGAATTTATTGCAGGTGGTCTATATATATGAGCTGTTGTGCCGGGGCGAGGATCCCAGCAGCGAGAGTCCCGAATTTTGGAACGAGTTCTTCCTGCTGCAGCCGAACTTCGAGGCGCTGGAGAATGAGATTGGCAAACTCAACAACGAGCAGCTGCAGCTGGTGAAACCGAACCTGAACACCCTCTTCCAGAGGTGCATCGAAATGCTTGACACGGGTAGACCAGTTTGACCTATTAATATATACCTCCAGCCACCTATAATCCGTGATTTCCCCCAGAAGATCATCCTAAGC


Search Again