CR00639

CRIMIC CR00639

Gene CG4829

CG4829

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OK80612

Images

Construct Sequences

sgRNA sequence
AAAGTGCACTCAGAGAAATGGGG

Amplicon 5' Amplicon 3'
TGCACCATCAGGATTAGCAACAACAATAAGCACCAGCACAACAACAATAGCAACAAGTGCAACACAACAACCACCAACAGCAACAACAACAACAACAGCAACCAGAACAACAACCACTAGCAGAACAGATAGCAATCCCAGCCCCACACCTAAAACATTTCATTTAACAGATGATGAGCAGCAACAGGAACCGGAAACGGAAACGGACAACATTGGCAATCTCAATCTGGGAATCACGAGCACAGCGACCACGCCATCGGACGACGTCTTGCCCAATGTGGCCGCCTCCACGGCGGCAACGACAGCGGCACCACCCACCTGGCTAGCGGATCAGATCAAGATCGATACCAGCGAACAGTACAACTCGATCCTGGGGGTCTACCAACATGGAGCCGTGAGTTCCGATAACCTTGAGTGCAGCAAGATCGGCAGGTAACTATATGCAGTTCTATGGGCTTTAAATTTAGAATTTAAAAAGAATTTAGATCGAATAGTGAAGGTAGAGGAATATGGGAATGAGCCACCTTTTGCCCAAACGATCGAGGTCATCAAAATTTCATTTTAGGATTATTACTAACACAATAAGAAGCGTTATACAATTTTTGGATCACCTAACAGAAAGACAGCAGTGACATTAAATATTAAATATTAATTGAATATTATTATTATTAGCGGCATCCTGCAGAAGAATGGCAGCGCGGTGGACGCAGCGATCGCCGCCCTTCTGTGCAACGGACTGCTGACCCTGCAGAGCATGGGCATCGGTGGTGGTCACCTGATGAACGTCTATAACCGAAAGGAGCGCCACGCCACCGCCATCGATGCCCGCGAGGTGGCGCCCTACGAGGCCACCGAGGACATGTTTGCCCAGCAGCCGGAGAATTCCGACAAGGGACCGCTGAGCATCGCTGTGCCCGGCGAGGTGATGGGCTACCATGTTGCGCATCAGAAGTTCGGACAGCTGCCGTGGGCGGAACTGGTGGCGCCATCGCTGGAGCTCTGCGAGAAGGGATACCATGTGTCGCAGCACATGGAACGGGCACTGGATATAGCTTTGCCGTACATCAAGGAGCACGAGCAGTACCAGTAAATTGTCGAAAAGCTTGAAAAGTGCTCTAAAAGTGTCTAAAAGAACGCCCC ACGCCCCATTTCTCTGAGTGCACTTTTCAGCAGCTTTTCAAGCAATTTCAAACTCATACTTTTGTGAATAGAACTCGATTCTAAGCGTATGATTCTTTACAGAATCTATTTGAATGCGGAAACTGGCAAGCCCCATGTCGCCGGAACTGTAGTTAAGCCGCCCAAAAATCTCTGCAAGACCTACAAACTTCTGGCCGAGAATGGACCCATGGACATGTACAATGGAACGATAGCCAAGTTGCTGGCGGAGGATCTGCAGGACATGGGCAGTATTATTTTGGCCGATGATCTGGAGTCGTACGAGGCCGATGTAATCAACTCCATCACCATGGACTTGGGTGACGACACCTTGTATGTGGTGCCGCCGGTCAGTTCCGGTTCGGTGGTGGCTCACGTCCTGGCCATACTGCAGGGCTATAACTTCACGGCACAGGATCTGTCCACGGAGGAGCTGAAGGCGCGTACCATTCATCGATTTGCCGAAGCCATGAAGTTCGCCTTTGCCCAGCGTCCAGAATTGGGCGATATGCATTTCATCGATGCACGAGAGCTGGTTAGCCGGCTGAATAGTCCGGACTTTGGCGATCAGAACCGGGCCAAGATCAATGATTCCCACGTGCTGCCCGATGCCCAGGCGTATGGAGCCAACTTCGCCGCCATCGAGGATCTGGATGGTACTTCGAATTTGGTTGTCTTGGCGCCCAACGGTGATGCCGTCTCAGTGACCAGCTCCATCAATTCCTAGTGAGTATCCATTGTTAGCCTCCGTGAGGTTTAAAAATAATCTGGATTAATCCATTCAATATTTATCCATCAGCTTTGGCTCCGGATTAATTGGACCCCGTACGGGTATTGTTCTCAACAATGGAATGAACGATTTTGCGGTGAAGAATAACATTTTCGCATTGCCCCAGTCGCAGTCGAATAAAATTGAGGCCCACAAGCGGGCGATGTCCTCGCAATCACCGATCCTTCTGGCCGATAAGGATGGCAACATGAAGATGGTCATCGGAGCAGCTGGAGGCAGCAAGATCATTCCGGCCGTGGTTGAGGTGGCCGCCAATGTTTTGTGGTTCGGCAAGGATCTACGCCAGGCGGTTGATGCACCGCGCTTCTACCATCAACTGATGCCCGATGTCCTGGAGTACGAGGAGGATGGCTTCACGGAATCCCTGCTCCAATTGCTGACCAAACGGGG


Search Again