CR00638

CRIMIC CR00638

Gene Moe

CG10701

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78972

Images

Construct Sequences

sgRNA sequence
GTGCATGAATCAGACTCTCATGG

Amplicon 5' Amplicon 3'
TCCTCGATGGGGTCCTTGATATGCTCGTCGGTGTCCAGGTCGCGCGACACATCGCCACCGGCATCGCCGTTCGTCAGCTCCTCCTCGTTCTCGTTCTCATCCTCGGCCACGTGGTGATGCTGCGGCGTTGTCGACGCGGCCAGCAGAGCGGCAGCGGCTTCAGCCTACAAAAACGACAATGTTCAGTATAAAGTTGAACACAAAATGGTATCAAGACTATATTCATTGGTTTTTTCGATGCCAACAAATAGTGAAAAAAGTGTACCGCAATGACCTGCTTGCGTCGGGCGTCTTCCACTTCGTCCTGCAGACGCTTTGTCTCCTCATCCTTGGCGTTGACCTCGTCCTGAATGCGCTGCACCTCCATCTGCTTGGCCATGATCTCCTCCTCGAGCTTGAGCTTCTCGACGGCCTCCATATTCTTGGCCTCCTCGAGGCGCTGCAGCATCGCCTGCAGCTCCTTCTGGCGCAGCTCCAGCTCATCCTTGGCGGCCTGCAGCTGCTTCAGCTGCTCCTCCAGCCGGCGGATCATGTCCTGCGCCTCAAGCAGATCGCGCTGCGAACGCTCCATGTCCTCCTGCATCTGCTTTAGCCGATCCTCGTACTCCTGCTGCTTCTTTTCAGCGCGTTCGCGTGCGGCCAGCGCCAGCTGCAGCTTCTCACTGCAAAAACGAAAGAACACCGAAAATAAGAAGGGAATCATCTGCTTGCAGATTATAGCCTGTGCATGAATCAGACT TGCTCGAATCATTATGTTTCGGGTCATTGAAACGTTGTATTTCGTTGAAATTCCCAAAGTTTTGATTCATTCAAACAGACATGACTTGAAATCCGTACTAACCGTTCCTGCTGTTTGGCATTCTTCTCCTCGCGCGCCTGCGCCTTCATCTGCTGCACATCGATGGTGTCCGGCTTGCGGCGACGCATGTACAGCTCGTGGTTGCCCATGCAGAGGGCCAGAATGCGCTTGTTGATGCGGACACGTGGCGCAAAGAACATAAAGTCCGGAGCCTTCTTGTCGATCGGCTTGATGATGAACTTCTTCTCCGAGAACGAAATGTTGCGAATCTCGGACCATGGGAAACCAATTTTCGGCGTCAACCTATCGTCCTGCTCGTAAATGTTCAGACCCAGTGCGTCTACGCCCAGCCAAAGATCCGTGCCCTTCTTGTTGCGGATCTCAAAGTAGTTAACGCCGTACATCTCCAGGTCTTGGGCGATCTTCAGATACTCCATCATGGCATCCTCGCGCAGCATGCTGCGATGCTCCTGCCACCAGGTCATAATCGACTGCTCCCACTCGTCCTTGGACATCTTGTGCTGGTCGA


Search Again