CR00637

CRIMIC CR00637

Gene stg1

CG33670

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OK80611

Images

Construct Sequences

sgRNA sequence
GGTGACGGCCCATTACCATTGGG

Amplicon 5' Amplicon 3'
CCTACACACCCCGAACAGTCACGCCCACACTTTTAAACAATTTTTAAAAATTTTCTCATTTTATTCCCCATAATCTATCGATATGTCCAAAAACTAATAAATTTCTCGCATTTCTACTAGCTGAGTAAAGGGTATCTGATTGTCGGGGAACTCGACTATAGCCATCTCTCTTGTTTATAATTTTTTTGGTTCAGCAAGGTCCAAAATAAGGCGAAAAAATAGCACCACTATCAATTTTTTAAAAAATTCGAATTATTGTAAAAGTACCTTAAAAATATTATTAAAACGGAACGTGGAAAGCTTTGTACAGCAACGTGACATGATTAAGAAAAAAAATCATACTGAAATATTGGTCGAATCCTTCATGTCTCAGGGAACATGGTTTAAAAGCCTGAAGTCCAAGGCGCAGCTATTAATGCTTATAATGGATACACTACCATAAATATATTAAGGTAGCGTAGTTTTAATACGCAAACATTTGTTATTAAGTTTAAAATTGAAAATTTAAGCATTTATTTTTTCGTTGTTCCTAATAAAGTTCCTTAGTTAAGTTAAGAATTCATAGAACAATTGTACTTATTTTTTATTTTTTAATAAGTGAGTGGCTTACCATTTTTTAAAAGGGGACTAATTTAAACCTTGATTGGGCACGTGGTGCTCTTTAATTTTAATTTTTCACAACAGAAAAATTTCTATCTGAATAATACTCTTGGCTTTTTTTATCTAACTCATTAAATTATCAGCGAAAATAATGAGACTCTTACAAATAAAATAAAATATTATAAATAAATTTTAAGTTCGTATTGGGAATGCTCATATATGTACTTCCTTATGATCTATGAGCAAAACTAAACTTTTGTGTAAAACAGCATATGTACCTGTAGGAATGATGGATTGGCAGCTACTTAAGTAGCCTTGAAAATGTCTCCAGGTGTGGGCAGTTTAAGAAAATATAAAAGAATATTAATATTGAAAATTGAAAAACTTACCGCGAATCAAAATTTTCCTTGCAGTAATCCAACGGGCACGAAAAGACGCTAAATGGTGGGTGACG CCGAATATAGGCGGGTTGGCTGATGGTGTTGAATTCAACGGCTGTATCTGGCTCAAAGACGAGATGGAGTTCATGATATGATTGTAGTATTGGTTTGATAATGCATTAAATTGTTCGGTCCATGTAACATCCATGTTACGGTAAGGGTTAGGGAAAGAGCTCAAAATTGGAATAAAGTTCCTATTTGTGGTAAAACCCTGATTGGTATTGACCATCGAATCAGACTGCGACCCCTCAGCGTTGTGCTCGACCCCCTCCACTTTAATCTTAACGGGCACGTTGGACTCCTCCGACTTCGGTTCCGACTTGGTCGCCAACTTGTCCGCCACCTTGTCCGGCATCTTGTTCGCCTTCTTGGATTTCGGCTGCATAACCGACTGTTCCCCCGACTTACCTTCATCTTCGATGGTCGGAGATTGAGAAATGCCACCGACTTGACGGGCGAATTCAGATGCCATTCTGGCCGCAGTGGCGGCAGATGGAGGACGACCACGTCGTGGCCCGCCATTATGGCTGAACACATGGGTAGCCGT


Search Again