CR00636

CRIMIC CR00636

Gene CG9657

CG9657

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78971

Images

Construct Sequences

sgRNA sequence
AATCAAATGGAATTTCTTCCTGG

Amplicon 5' Amplicon 3'
AACTGCGCTTAGAGTCCAGGAAACAAAAGGCCAATGGCTCAGAGGAGGCGGCGAGTAGTGCTGCCTCGTATTTGGTTGGTGGCAGGCAGATGAAGATCTTTCCCATAACCATGTCACTGATATCCAGGTGAGGAATAGGTTAGAATTCTACGATAAATCATTTTTAAAGATATTTTTTATTTTATTTTCCCTTTAGGGGGAGTTAAGTAACTTTTATATCCAAAATAAATATGATAGAAACGTTTAATGAAACTATAAACTTAATTTTTTCAACTATAGCCATTTGCTAAGTATATTATAAAGTCGAGATGGAAAGCCCCATTCTCTTCTCACTGTTAAGTGCTTAATGTGCCGGAGATAAGATAGAATTAATCAAAGTACCGCGGAAAACCCCATTTGTCCTCAACTAGAGAGCTTGTCTGAAGATTCATACAGCCATACAGGGAAAAAAATGCCGACATAGTGTAGGTTGTAGTTTGCTCCAGTTTTCGACCCGTTATAGTCGCTCGCTTATTTTTAGCATACTTGTACAGCTCGCTCCTATCAACGCACCAAATCAAAATGTTTCATAATTAATAATTGGCTTCCACGTTCGCTGACAATTCGAGCTACCCGCATATGCAGGGCATTCAAATTGGCGACGGTCAATTGGCGACTACGACTGCGAGTCCACTTCCACTTCCACTTCCCCGAACCCCAAATGCCCGATCTCCAAGTGGCAACTAAGAAATGTATGGAAACTTGACTTGGACACCAGAGAATTACGACGACATTGGTGCTAATTGAATTGTATAAAACGCACTTTGATCTCTTACAGATGATGGATGATCGGTGTAAGGCCTTTGTCGAAGGTCAAGGCGACTCTACCCAG CTCTACCCAGGAAGAAATTCCATTTGATTAAGCTTAAGTTTTAATATCTTTACTAAGATCACATTTTGCTTTTCAGCTTTATATCTGGAATTACACTTTTGGGTACTCCCACAGAGGTTTATCTTTATGGTGCTCAGTACATGTACATTATGGGATCGCTGGTTTTAATGGGCTTCTGCATGTACTACTTCTTCTTGCCGGTCTTTCACGAACTCAATTTGATATCCACTTATAAGGTAAGCTTATATCTTGTTTGTATAACGAATCAATTTGAATGGGAGGATTTTATTTTAGTATTTGGAACAGCGATATAACCGAAGTTTAAGGCTTTTCGGATCTGTCATGTTTATTGTGGCTTCGGTGAGTTAATCTCAATTATAAGTAGGACTCTCTTTTATAATTTCTTTTTTTTTCTTTCCAAGCTACTTTGGCTTCCAATTGTGATTTATGTACCGGCTATAGCATTCAATCAGGCCACTGGAGTGAACATCCATATAGTGACGCCCATTGTGTGTGTGGTTTGCATTTTCTATACTTGCATTGGAGGTTTGAAGGCGGTGGTTTGGACGGATGTCATCCAAACGTTGATCATGTTCGGTGCGATGGCTTTGGTTTTGATTAAGGGAACCCTGGATATCGGCGGACCTGGAGTTGTGTGGCAGAAGGCCCAAGAAACAGCTCGATTGGAAGTACCCAATTTTAGTGCGGATCTAAGTGAGCGGTATACCTTTTATTCCCTGGTTTTGGGCGGTGTAGCTCATTGGCTCAAGTCAAATGCAATTAGTCAGAATATGATCCAGAGATATTTATCGCTACCCACGCTTCG


Search Again