CR00634

CRIMIC CR00634

Gene CG6574

CG6574

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no band80610

Images

Construct Sequences

sgRNA sequence
CGAAGGCAAAAGTTTGACTTTGG

Amplicon 5' Amplicon 3'
ATCAGAAGAGATGCTCGCGGTCTGAGCCTTCCGGTGTGCAGATAACCAGCGGCCAAAGCACTTAGAGCAGCCAGAGCTGTCAGGACAGCATCAACGGCGCCGTTCCACGCAATAACAGGCTCCGGTTCGATCACTTTCCACAGAACCTGAACGTAGTAAGTGACCTGCAGGTAACCAGCCAGTCCAATGGCGTACCACAGACTCCACTGAACGACTCGCGGATTGGTGTATGCATTCCGAAAATGTAGCCAAAGAAGGCTCAGTGCTCCTGGCTGCTTCTGAGTATTCTCCTGCTGCTGATCCATCTCAGCCAGGTTTCCCACCCCGGGTAGCTGAGTCTGCGGCTCCGTAATGGACAACTGCTCCCGATGAAAGTAAAGACTCCTATCCACGCGGGGCAGGCCAAAGGCCCAAAGCATGGCTATAATCTGAGCTGTAGAATATATGTGCATGATTAATGCCCCAAGTTGTAGGTCATTTATTGTACGTACTGCCCAGCGTTATATAGTTAAGCTCCTTGTAGTTCATCAGCTCCAGATTGAGCATAAGTTGGGAAGTGATGCCGGAAACCAGTTTGCCTGCAAACATGGCTGCTCGGGTGTGGGAGGTCACTCTGGCATAGTATTTCTTGTCCACTTTGGCATAGATGTACGTATAGTAGGCCACCTCTGCGGCCATGTAAGTGCCGAAGAAGAACTCCAGGATCTGAAGCGACAGCAAGCTGGTGGTCCAGATGAGCATGCTCCATATTATCACACCCGCAGCTCCAATTGTGATGATCAGCGGCTTGTATCTGAAACATAATACATATAGTTATTATAAAATGAAGCCTGTTTCCGTTCGAACAGCTTTTAATTGCAAAGCTATCAAATCGAATTCAATTTGCTGAATCACAATAAATTTTTGGCTAGCGAAGGCAA TGGAGTAGGTCACCTTCTGGTTACAAATAAAATGACTGGTTTCGTATTTGATTACGAACAATTTTTGTTATAAAATATAAATATCAAATTGGCTGATAGCAACTCAGTCCCACGTTTAATTTAAGAAAATACATTTTATCCTTAATTTAAAAGATAAATAATTTTCAGCGAATAGTTACCTGAGAAAATCTGTTATGAGAAATACAAAGACCAACTGCACCAGGTAGGAATAGGTTCCCACTGGGTAAACATCGTGCGTTAGCTGGAATGGGAAGAAATTTGATATTCTATGGAATGGATAGATGGTGGGAGATGCCACTCACCTGCTGCTCCGTGATATTCCGCCAGGGACCCAGCAGGTACTCCGTGACGTAGGGCTCCGACGGACGGATCTCGCGGATGCAGCCAAAGACACAGAGGAGGCAGGAGATCTTCAGCCACTCCTTCATTTTCGAAATTTCGTAACGGTCACTGACGTAACGTGCGCTACGCAACGAGATTCAGCGGCGCAAGCTCTTACGTGAAACACTGAAGTGGGATGCCGTTAGCTGGGCCTTTCTGCATCTGGACAGGTGAAGCTCAATATATTGCCTAGATTCACGGGCAATCTGGTGTATCAGGCCATGGTCGTCGTCGCCGGGTGCTCAAATCTAATCTCTTCGCGACGCGAATCCGAAATTATCACTTCGACGTGCCCGAATTGTATTTACACTGAAATCGCTGTTAGATAATTGCGAATTTACAATGCGGTTTGAAAGTCACAAGCAAACAATCGCATGTGGAACGCACAGGTGGGTGGTCCAGTTTAAAAGTTCTCCAGTCACCCTACACACGTGTCGCACTTCA


Search Again