CR00631

CRIMIC CR00631

Gene pros

CG17228

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78970

Images

Construct Sequences

sgRNA sequence
GAGCCCAACCGAAACGGGGCGGG

Amplicon 5' Amplicon 3'
GGGTTTCTTTCGCCGCTTTTCATGGCGGCAGCTACTTGAGAGTCTCGAGCACAATGGCCAGGGCCCTACTGGCAAAAGGCGCTCAAGGATACGCCCACACACATGTTAGCCCACTCACTTACACCCGCTCACACATACGCCCACACACTCGCACATCTCACGCTGTTCTTTTTCCGTGTTTTGTTTCTCATCGAGCCGCTTTCCGTTTTTTTGAGGTTAAGTGTCCTTTTGGCGCTTAGAGCAGCTTCCCAGCCATTCCCCACCACCCTCCACCTTCGACGCGTGAAAAGATCTTGCTGACAACAACAACAAGAACAACAACAACAACAAGAACAACAGCAGCAGCAGTTACAATTATATAAATACACACACTCACACATGCTACATACCACATTCAGACACTCAGATACGATACACGCTCCATTCTGTATATGTATATAGACGTATATGACTTGTACAGATGCTTATATATAGATACAATGCAAAAGTGTTGCCAATTACTTCATTAATGTATGAGGTAGAGATGTCTGCATATGTGTGGGTGAGTATGTGTGAGCTTATTAATAACATTCTACTCGTTCGTATTCGTAACCGTAATCCGTGATACGTGATTTATTGCGGAGGAAGTGAAGAAGAAGAAGAAGGTGCAGCGAAGAAGGAGACACACGCACACACGAACAAAAAATACACACACACACAGAAAACACACGCACCCACACTGTCACGCACACATTCAAACGAAGTGAGAGTGAGTTAGAGGGGTGCGGCATGGGTGAGAGATGAATGCACTTGACAAAGCAACGCCTGCCTGCCTTTCAACAAGTGTTTTAGTGGTTTTTCTTCTCACTCTGCCACGCTCTCGCCTCACTCTCTCTCTCTCTCTCTCTTCGTGCGTGTGTGTGGGTGAAGGCCCAAATAAATAGGCTACGAAATATTATATGCAAACTAATTAGCACTTCCGTCGAGCCCCAACGCCATTGCATCTGCACATCTGCAGTTCCACTTGCACGGCTTATTATCTAAATTAAGTGGCGCATTTGAAACCGCCAAGCCAAGCTTCCTTTTCCTGCCACATATGGTTGCTTGCATAAGGATCGCCTCAAGCTCCTTTTCACGCCAGCCACAAAGCTAATTGCAATTCAAACCAAACCGAGCCCAAC GTTGAGATCCTGGCAATCCCTAATAACTATGGACACCCGGCACAATGAACTGTCACACAAAACTGTCACACAGCGATTCCTTTTCTTTCGGCCAGCCCAAGCCATCAGCCTCATTATGAAGCCATCCCAAAACCACCCACCCGATCCACATCCCCATTCCAACGCAGCACCTCCCTCCTGCTCTTCAAGTGCCAGCGCCTCCGGGGAGCCGCAAGGGGGGCGTGCCAATGGGCTGGGGGCCAGAAGGAAAAGATTTTCTATTTGCGCATTCTGCGCTTATTGTTTGGAAAATCAACACGAGCGCCGTAGCACAACATGAGAAATGCATTTGGCGCTGCTACTGGGAAATCTTGAAATTAGCGCGATTATCGGAGCGTTGTCAAGAGGGGTCGATGCGGGAGGGTTGGGGCGAGGGACTCCAAAGGATTCCCAGCGAAAAGACAACAATTAGTGCGCGGCAGACAATGCAGGAACTGCGAGAAGAGAGGAGAATCAAGGGGTTGGAGGAGGCGGAGCAGCAGCAGCAGCAGCAGCAGAGGCAGTCAGGCCGGAAGACAAGCAATCACTTACAGTTGCCAAGTTAAGCATATACCCCTAGTCCTATCCCCCTGCCACATCCTCGCCATATCCCCTTGCGAATGGCAGCTCACACACAAATCACTTGACTAAACAAGGCGACGCAGCAGCAGCACCAGTAGCAGCAACTGCGGCAGCATCGCGCTGCACTTGCTAATTAAATCCCCAACCCCCAAGGCAGTCCTGGGATAAAAAAAAAATAGGAAAGAAGGCAAAAACCGCAGCTAGAAGATGCCGCCCCGACTTGCAATTGTTATTGCACCACCACCAGCTGCTGCTGCACATTTGAGATTTATTAAAAATTCTTTACACACCCACACACACCCCCACACCCACAGCGACACCGACACCGACATATACACGACGCGCCTAAGAGTATG


Search Again