CR00625

CRIMIC CR00625

Gene CG10505

CG10505

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK no band80608

Images

Construct Sequences

sgRNA sequence
GCAAATGGCATGTCTGATCCAGG

Amplicon 5' Amplicon 3'
GATGGCACCGATGATCTCGTTCATGAGCTTTACCCGTGCATCCCGATGCTTGGCGGATCGGGTGCCGAAACTAGCAGAAGCCTTGGCGGCCCAGGCTTGCAGGGGTATCAATATCACAATGAAGGCGATTCCAATCAGTGATGTCCAGCCCACCTGGCGGGTCATCAAGTAGCCAAAGATACAGGCCTCCACGGGACCCTTCCACAGGTCGTGAAAGAAGTAAAAAGTCAAGTCGAACTGCGAGAGATCGATGGACATCACCGAAATGGCCTGGCCTCCAAGTCCTTCGCCACTGCTCGCCGAGGCGCGCAGACATTTCCGGTAGACCAGGCCGGCACAGGCCAATCTGACCCGCGTTCCCACCGCGAATACGTAGAACATAAATGGGTGAAACACTAGGGAGGTGACCAGCGAGCACAGGACAATGCCCATGGCGTACAGATAGGCACTCTCCTTGGTCACCGTCGTCTGGCCGTAGGCGAAGTAGGAGATCAATCCTCCGAGCAGCAAAGGCTGGAAGGAACTGCAATTAAAGCGGAAGTGAAAAGTGAGATTGCTGTGATTTCCGGAAGTATATTTAGATTCTGTACTCACTGAATAGCCATTTCCAACAGAGAATATAAAATGCAAACGGGAACAAACTGCCATCCGTAGACCTTAAAGATCAGCCGCATAAGACTCGGATTTTTCTTCTTGGACTCCTTCTCCCAGTGGGGCTGTAGGTTTCTGGTCAAGGACTCACTATCGAAACTGGGCAGGTGTTCGTACAGCTTACTCGCGTCCAACTCCTCCCGCCTGCCCTTCCGAAAAACACTGTGCATCCATCTGAAGGAGGAAAAATGATAAGTCGTTCAATATCTTATCAAAGTATCTCCAAGGTAGGCGACTTGCAA GGCATTACTACGTGACTGCCCAACAGTCAATGGTCAATCAATATCGCGAAATTCCGATTTATGACCGAAATCTCATGTGGAAACTATGGGTTAAAAATAACCATTATCACTTAATGAGTTTTGAAAAAGATATTCCAAAGCTGACTTCTGGGCATTACAAGTATCTTAACTTTTTTGCTTAAACTTTTCGGAGATGTTGTTTATCAGCACTTATTAGCAACAATTAGCACTATCCTTATCGCGAGTTGTAAACTATTCACTGATTGACCATGACCATCGTTTCCGCAGAGATTTTCACTTTTCACCAATAAAAAAAAAATATTGACGACTCACAGGAACAGCCACTTAGAGATTATATTGGCCTTGATAAACGGATTACTCTCTCTTTTCGGACTCGACTGCTTAGAAGCATCCATGGCTCCATATGCTCGCGGCGCCAGACGGATTGAATATGCCCCAAAACGGACGGTCGAAGGCGCTTTTAACGACTTCAGCACTCACAGACGGAGCAGTGACGTCTGTGGATTATTTGTCCGGAGAACCACCATCTTCTACGGTTTGCACTTGGCACAACGCCTGTCCAAACGGCGATAAAGTGGCCAACTCAACACGTTTTTTGAGAGTTCACCGCTTTTGATAGTGATACGTAGTGATAGTGACTAAGGCGTAATCGATAGCGCA


Search Again