CR00624

CRIMIC CR00624

Gene CCHa2-R

CG14593

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78969

Images

Construct Sequences

sgRNA sequence
GGGTTGGGGCGCATGTAGCATGG

Amplicon 5' Amplicon 3'
AAAGTTCTGCCCCTACGCAATGTGGTCTTACAAGCCGGATTCCAGATTCATCTTTGACCATTTACAAGCTGTATTCTGTCCCACTTTTATTGTTTTCTATTTTTGACAAGAAAACTACGAAACAGAGGCAACCCGACAGCTGGCGGTGGGGCTTTGGAAGGAGGCCGTCTGCTATGCAAATGTTTATTAACTTTTGAAACTTGTGCAGGCTTGTAACAGAAATTCAAATGTACATTGAATCAAAAGTTTCTGGGCCACGATGTTGGCTTGACAGCAGTCGCTAAGGAAGCCATTGCCAGAGTTTGGAAGCCACTGTCTCCCTCCCTTCGCTTTGGAGCAACTTAATCTGTAAGTGTAAGTGGTCATAAGTATACATTGATTGCCCGAAAACTGCCTCTACTACACTCCAAAATGGTCCCTGATTGCAGTGAGCCACTAGTTGGGGCAGTTATTGTGGTGGCCAGCGTAATGGTCCTGGTGGAAAGTTAGCAGTTTGCTCGACGGCTTTGTCGCGACTGTTTGTCTAGACACGATGACTGGGAACGTGTCAGGTTGGAATTCATGTCACATGCAATCAGCCAAATCCAGCAGTTCTAATGATTCCCCCGTCCGAGGACTCAACACTCGTTCTGGCTGGTTCACAGGAGGTCGTTGGTGTCAATGTCAAGCTGTTTTGCTCTCAATCGTTATTTTACTTTGCTCTGAACAGCATTCGTCTAAAAACGGGTTGGGGC GGCATGTGTAGGTGTCAGGACCTTTCCAAAGGATTTTGACTTGCCCTTGAAAAAAACAAAGGCATTCCAGCCCAAAGGAACCTAATTCCGGGTGAAATGGCAACGAAACAGACTTGATTAAATTCGAGTTATCTATAGTAACCCTTTGTCGATTTCATATATGTACTTCCAGATACATTCTTTCACTGGCCCTGGCTGATCTGTTGGTTATATTGGTGTGTGTACCTGTGGCCACGATTGTCTACACGCAGGAAAGCTGGCCCTTTGAGCGGAACATGTGCCGCATCAGCGAGTTCTTTAAGGACATATCCATCGGGGTGTCCGTGTTTACACTGACCGCCCTTTCCGGCGAGCGGTACTGCGCCATTGTAAATCCCCTACGCAAGCTTCAGGTGAGTCACTGTCGAACGACAGTTCGGAATGGGCTTACACATATTTTTCTTCCCCAATAGACCAAGCCGCTCACTGTCTTTACTGCGGTGATGATCTGGATCCTGGCCATCCTACTGGGCATGCCTTCGGTTCTTTTCTCCGACATCAAGTCCTACCCTGTGTTCACAGCCACCGGTAACATGACCATTGAAGTGTGCTCCCCATTTCGCGACCCGGAGTATGCAAAGTATGTTGATACCACTGCCTTTCCCGGCCCTCACTTGTACTACAATAGATCCATATGTCAAATGTTAGGGCCTGGCCATTAACTTGCTGGAGCCTCCG


Search Again