CR00623

CRIMIC CR00623

Gene Tep3

CG7068

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK78968

Images

Construct Sequences

sgRNA sequence
CTATTCATTCACGCGTCTAACGG

Amplicon 5' Amplicon 3'
TCGTTTAACACCCCATGGCAGAATCAATCAGGTGGAACATCGCTACTGCAACTGGAAACGTGAAGCCTGCATTTTGCGGACCATTTGAGCAAAAGCGAAATTGTTTTTGCCATTTACCTGTTGGTTGAAAACCGTTTTGCGAGAGCGACCACCATCGAGGGAACCTGTTTTTTTAGGCTAACAAACGTGACATAAACACAAAAGAAAATTTTTTGGTGGGAACAGGTTAAACCCGCCGCACCAATTGAAATTAGAACAGGCGGTAAGCAGTGAATTACCAGAGAAGGTGGCATAGTTAGGAGGCAGCTCATAAGTTTAGCAATTTAGCTGACAACTAAATGCATAGCCCGAGCATTTTAAAAAGGCAGCCAAATGTAAAAAGCACCAAAAAGGATAAAAAAAAGAAAAAGCTTACGTAAAAAACTAAAGTTACTCAAGCAACATAAGGCACCTTTCGAAAACAAGTTAGGTGTACGTTAGTTTGGCTGCAAAATAAATCCATTAGTTATTAGTTACAACTTTTAAATCCTGTTTTTTTTCATAAATTAACTGGTAATAAGGTAGCTTAAATATACCATGATAAATATATTCAAATAAGCCGAAAAATCTTTGATTAACAGCTGCTTATTGTATGGCTTAGCTGATTTAGGAAGCTTCCACATTCTGAATTTCGATGAGCCCACAAAAGAAAACCACACAAAAGTAGTTATAGCTCGAGCCACTCTGCCGTACTTCCCACAACCCCGACCCCAAGACCACAGACCACCAAACCACCTCCAACCATTTCCGACAGATACCTCACCGCAGCGATTGATGCTGACCCGACCGAAAGTTAAAGTACAATACCCTCTTTCGGGTTGGGGTATTGT GTCTTCCGTTAGACGCGTGAATGAATAGCGAAAAAAAGATTCAGATAGCATAACAGCATAGGTGTAATCCACTTATCTACGAACATTAAATCTGTAGCTCTTTTTGTTTATTTATTTTACGGCAGTCGCCGGCTTGAGGTTAAGTCGGGTTTCGTTTGGAAAAAATGTTGTTCAAAATGTAAGGGGTATAGTAATAAGTTTAAAATCTTCACACATAGTTTTAAAGATATATTTCTCGTTTTCACTATTTTTGTAATAATTTAATTGTAGTTTATACTCCATCATTGCTCCGAATACTTTGCGTCCGAACTCGCAATTTCATGTGGCTGTGAGCTTGCACAATGCACCTGAATCTGCCACATTTAAGGTGGGAATCCTGGGGAGCTCTTACACGGACTTTAAGACCGTGGAGTTACGGCCCTTTTCCACACAGCTATTGCACTTTGAGGTAGGTGGTAACTATACATGATATAGCAAAAGACCTCCTATTTATCACAAATCAACTTTAGATTCCCGCCTTAAGAACTGACAGATATCGCCTAACTGCTGAGGGCCTTGGAGGAGTTCAGTTTACCAATGAGACTCAACTGCACTTTGAGTCCAAACAACATACGGTTTTGGTTCAGACGGACAAGAGCA


Search Again