CR00622

CRIMIC CR00622

Gene ppk

CG3478

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 OK OK79278

Images

Construct Sequences

sgRNA sequence
CAAAGCTTTAAAGACAAATAAGG

Amplicon 5' Amplicon 3'
GTTTTGCATCAGCGTGTAGAGTTCATCCTGGGCCGATGTGTAGCAATTGATGTCCTTGAGGCCACAAACGGGAGTGCCAAGAGGTTCTATACAGAAAATTCGATTAAATCGAGTTAATATTTTATCAATTCCAAAGTTCACTCACTGGGCATCCAGAATTTGGCACAACCGCATTTGGAAACCGTATAGTTGGCCAGACATTCGGTTTGGCAGTTGCTCTGGGAATAGGAACGGAAGAATCGTAGCGATCGCTCATCATCGAACAGACATTGGCGTCTAAATATGGATATAAATATGTTTTGTATCGCATAGTGTCATCCCTTTTAACACGAATCCACTCACTTTTCGGGTGTAATTTCGTGCAAATTGTCAGTGGACACGACATATGCTGGCAGCACACTGACCAGGACCTCATCGCCATGAGGGACTAGGATATAATTGCCCGTCGTCAGCGGCACACTCTCCGGGGAGTTGAGAAAGACCTGTCAAATTACACATTAGCTGCGCACCGGTCCACACCCAGTTCTAACCACACACCTTATAGCCCTGTTTGAAACTGCGACAATCGTAGTCGAAATTATGCTGCAAACCCTGCAGAAAGGCGAAGAACCCATTTTTCACCGATGAGAACACCGTCCGTTGGGGATACGCATTCTGACCCTGGTCCACGAATCCAGTGTCCAGTGACCAATTGCCAGTTATGTTGTTCCACGGAGGCAAATCCACATCGAAGTACTTGTTGAAGTCCACCACATCCGGATCCACATAGCTGATGAACTTCTCGTCACGATAAATGTCCTTGGGTCGCAGTCCATTGAATTGATAGCAGATACCCTCGTCGGTGGCCACAAAGTCGAAGATCTTGTCACAGAAGTAAAAGCGACCATTCCACTTGCAAAACGGACCCGTCTCATTCTTCGATATACTCAAGTCAATCAGAGTTTGGGTTACGTCCACGTTCGGCGGATTTAGCTGCGATAGCAATGGAGTAAACCGCTGCACCACTTCCGAATCACAGATGTGCATTGCAACCGCCATTCGAGCCAGGCTAAAGATATGGAAAATGATTGGTGTTAAGACTGGTGATTTTACAAATC TTGAAAAGAATAATCGAGATCAGCAGATCATCTGTATATAAAATTTGTTAAATTACTAAGTGATCTAAGGGCCTACCCTTAACTATAAAAAGTATATGCTGAAATACTCAACTCCTCATCATCCAAATCGCTGATATTGCCATTCTGTTTGTACTCCTCCCAAAGTTGTCGCGATACGTTAGTATAGTCAAAGACATTGCGTTCCATTTTGATTTCCGGACAAATGGTAATTGTGGGAAACGGTATCTTATGCACTGGCACCAAAGTCTCGTCGAAACCTAGAATAACCGGCGATTCCTGCCACTTTAGATAGGTGTCCCAGATAAGTGAAACGGCAAAGTAAACGGAAATGCACGTGAAGAAAAGCCAATAAAGTCTGGAAGAAAATCAAAGTTATTCTATAGGTTCCTAAAGGGCTCTATTCTCTACAGACTTTTCATAGATCGGTCTGTGAACCTCGAAGATGTAGCGTATGCCGTGAATGGTCGTGCTCTTCGCATACTCCAAAAGTAATCCTTTGCAGGCTGACAGAG


Search Again