CR00621

CRIMIC CR00621

Gene JhI-21

CG12317

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OK80607

Images

Construct Sequences

sgRNA sequence
AGAATACCACCCAGTGGGTGGGG

Amplicon 5' Amplicon 3'
TTAATGGGTCGGGGCAAGTCGGGCCTGAAAGGAATACACATTACACATTGGGTTCAGAAGAAGTCAGTGATATCACTCACCTCTTATGCCGGAGCCACAACATTCCGGCTATGCTGGCCACCACTGAGAGCCAGAGCACCGAGCTGAAGTAGTTGATCAACTGGTACACGTTATCCGTGAGCAGCATGAGCAGCGACATAAGACACTGTGGGAAAAATGCGCTTACATCAATGCACAATTCTCTGCTGATAGCTGATTGGTGCAAAATGCTCATGCCAACTCACCGTGAAAATCAGGGAGGGAATGGGCGTCTGTTGTTTCACGTGGAACAGCTGGAAAAACTTGGGCAAATGCCCCTCCTGAGCCCCAGTAGCGAAAAGGCGCGCCGATGTGAAGAGCACCCCGTTGACGCCACCAAATGTGCTTAGCGCCACGAAAATGGGCACCATGAAGGCCAGCGGTCCGAACACTCGGTTTCCAAAGGTCACCGCCACGGCCAGCGAACTGAGCATCTCCGGCTTGTTTACCACGGCGAAATAGGCCAAGTTGACCAGAACATAGATGCTCGTGACCAGGGGCATGGCTATCCAAATGGCGCGCGGCAGATTCCTGCGCAATGAGAAAACAAAGAAACCGAGATCAGTTTTATACAAAACAAAAACTTCTAACTACTGTTTTTGCAAATAACTACTATCTTTAATAGTTGACTATGATGTTTCATTCGGAACTAAAACATTAAAAAGCTTTCAGGTAAAATAAGAGATATCTTATCACTTTCGATGACCGTTGATATAGAAAACATTTACCTTATACTCGAAAAAATCATAATTGGTTTGTAATAACTAGAAACATCAGAACTAAAACTAATCTACGGGCTTTACTGCGCATAAGAATTGAGTTTCCTACTTGAAATTTGTTTCAGTGTGTCAAAGAACGTGCTATTCAGCGAGAAAGCCACTTGGCTGTGCAGGGAGCGTAGCACTTAAATTGATTGCAAATTGAATTCGTTAGGGATGAGGCAGCAT CACTGGGTGGTATTCTAGGAGGAATGACATCAAGGACACTCAACAAGTTTCCACTTGTTGCTGCCTGCGCATGACGCACAAGGAATGAATGAGGCAAATAAACCCAGCCCAACCCAACCATTTATCCTTGTCACCACTACTCACTTGTATGGATCCTGTAGCTCCTCCGTCACAAAGTTTAAGTAGTTCCAGCCACCAAAGGCAAACAGACCGGAGTAGAAGGCGTAGCCAATGTTGCGGGCCGTGTAGATACCCTCCCACGGATTTCTGAAGTTCTCCAGCTCGCCAGTGGCCATGTAGTACAGTCCGGACAGGATAATCATGATGAGGGCCAGCAGCTTGCCCACCGTGAACACATCCTGCACTTTCATGGACACCTTCACCGACAGGCAATTGATTGTGGTGAGCAGAGCTGGGAGAGTGGGAGTTTCAATTAATTAACATTGAGTGGATTGTTTAACCAACTTACTTAGACATATGGCAGCCAGCAGTTTCACCGCATTCTGTGGGGGATCGCATTCCGGAAAGAATGGCTTGACCGCATAATGGGCAAAAGATAGAGCCACAATGGTCTAAAAAAAAAAATAAAACAATGTATTCATACTATAAATCCCACATGCCATTTGTTTCTAGCGGAGAAAGCTGTCCTACTCGTAATTGAATTCAATTCCGGTCGAAGGTAGCCGCCCATTAA


Search Again