CR00616

CRIMIC CR00616

Gene CAH8

CG5379

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78967

Images

Construct Sequences

sgRNA sequence
AGGCTACGCAATAGGTGAATAGG

Amplicon 5' Amplicon 3'
ACCTCCTGTTACGTAGGGCTTCACGCCATAGATCGTCGTCGGAACCTTAAATTCCACTATCAACGGAAATGGATTAGTTTTCCCTTTCACTTGGAAGTCCGTCTTATAAAAACCTGTGTGTCCACTATTCCTAATTGTCACCAGCTCATCGAAGAACTCATCATAAAGTGCGAAAATCAGAGGCGGCAAGTTAAGGGGTATCGCCTTGCGTCTGCTAATCGCAATGGGCGACTGTTCTGATCCACCACAATTTGGGTATTTTTCCGGCCACCTCTCCGGGGATTTGTAGTCGAAATCAGTCGATCTGAAATCTGTAACAAAGTTATATAAGTCTTTACAATTCCCACACATTCTTGATTTATCTTGGGCGAGCTTCTCCATATTTGACGAAATACCCAAGAGCATCCACCACCAATGGACGTGGTCACTTTGCAAAACCATTAGGAAGGCCGTTGGAGCAATTTCTGCACTTGCCAATTTCCCAAAACGTCTTCGCAATTTCAGCTATTTCGCAGAGCCTACGGATTATGTCTAAGCGTAGCATAATTGCTTGATTTTGGGTCCGGACCATGGAAACCTCCTTTTGTTTACATTGTTCCGAGCGATGGATCGCACACGCCGCTCTTATAACAATGGATGGTACTTCGACATCTACTCCGCCCCCGAAATTGACGCGCTCATTGGGTTTCATGGGGCATTTGTGGATGCAAATTTAATTATTGTTATTATTTACAGCCACCGGGTTGTTTGCTATCCATTAGATGAACCGCGATGAGACAGCTATATGGGCGTCGAGTGTGACATATGAGGGTTCGGTTCGGTTCGGTTCGGATTGGTTTAGTTCGGTTCAGCCGGAGGGGATGGCTCATAAATTCCCGTACGGGCAAAGGCTAC GGTTGGTTCCGGGTCGAAAAATCTCAAGATCTGGGGCACGTTGTCTGGGGACGACGATCAGTCTGCTATCGATGGCGTCTCAATACCAAGGTGATCCACAGTTGTATCGTATTTCGTTGGATGCGACACACCTCACTGGCTTGCATTTCGGTACTCACTTGCGGCGAACGGCAGCAGAAACAGAAGACGCTGATAGAAGTCATCAAGAGCCGGAAGATGCATTTTCCACCTGATCACTCGCTATACACTACTACAGGCTATAGGAGTTGTCTTCGCCAATCTAGTCCAAATACGCTCCACACAGTAACCCCTGACCGAAGACCGAAGATTTCCAAGCGCGCGTAGCTCTGCAGACTGAACCACGATCGGCTTAGGCCAAAACCTTTATACCAAAGGGCCACAGTCTGGGCTTTGGTTTGGCTTCCGTCTCCGTCTCGTGGACTGGGAGAGCCACATTGTCAAACGCTCCACGGAGCAGCAATAGATGGTAATCTCGACTCGAAGTTGTCATACCCGCTACGCGTACTGCTGTCTGAGCACCGTTACCCCGAAATTAAAAACTATAATTGAAAAACTTGGTTCGATGGGGACAAATGCAGATTACACAAATTGAAGTTGAAATTCCTTGGCATAACTTAACCCGTCTATGGTATAATATCTAGGTTCTGCAAGTTCCATTTATAAGGCGTTTTATTTATATAACGGAGAAAGGAAAAGTTTATTCATATATTTAGGTTCCAAATAAAGTACTTCATACTTTAACATTGTTTAATAACTTAATATTGCGTATATAGGTAAGTTTGGACATATTTGAAAGTTTAAAATACCCTGCATCTTTTTTGGTTACAATATTTTAAAATATTTCAAATGTTTTTTTTTTTATTAAAACGCAAGTAAATCGTGTTTGCTTTGATCTCTGCTTATGACATCCTCTTGTAAGTCAGATACGCGGCTCTTTGG


Search Again