CR00611

CRIMIC CR00611

Gene CG10082

CG10082

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78966

Images

Construct Sequences

sgRNA sequence
GATGGGTTACGAGGATTATTAGG

Amplicon 5' Amplicon 3'
CACTCCGCTCGTCTCATCTCGATCCCTAGAGATCCTCAGTGATCAGGTCCGTCCTGCTCCGTCCTGTCGGTTAGAATGCAGGCGAGCCAAATCGAATGGGTTTGTATGATTAAAACACATCAATCTATTTATTTTACATATGTATGTTAATTTACCAATGTTTTATATACCATACAAATACGATACGATACGATTTTAGATTCTACCATATGATAGTTAAGACGATACCATTTTAGTATGTTAAGTTGAGGAAATTCAAAGCCAGTTTTCTACTTTACTATGCACCTGTTACTGCGTCGGTTCGTTAAGTCTCTATCTATCTGTATTGCACCAACTTAGCTTAGGACTAGGCCATACTACCTCCATTTAAACGCATAAACATTTGGAAGCCATCTGATTCCGTCTGTCGTTGGAAATGCATGATGCACTTCTCGAATTCATTGCACCAAAGAAATTTTTGAAAACTCTGCTCACATGATCAAAGAAGTTATCAAGTTATCAAAGGAAGTTGTGATCAGTTGATTGAAACATCACTTTGCCTTGATCACCTGAGCAGTGTTCAATTTCCATCATCCTTGAGAGTGATCGTGTTTGTCTGTTCCGAAACATTTCGTGTGTCTGCTAATTAAAACCGAGGTACCCGCGCCTCTGCCTCTGCCTCTACATTCA CGTAACCCATCTTTCGTGTCGAATCGATGCTAAAATACAAACAACTACAGCCAGATGAGAAGAGTATGCTTTCTCGCAGTTTAATAATCCCTTTACCCGGCTATTCTCTGTGTCCATTCCAGGCGTCATGCAGGCCACCACCATGGGCGGAGCCAAGCTGGACAAGCGCTACTCGCCTAGTTTCCGGGATGACGCGGCCGCCGTTCCCGTTCGCAAGATGAGCGCCTCCAAGAGGAAGCGGGATGAGGTGCTGAGGTGGGTACTTCATGTGCATTCGAACGCTGAAAATCATACTCATAATCATTATTTCCTTGCAGAATGAAGGTGCACAAGAATGGACAGGCCGCTGAAGTGATCAAAAGCATCTCACAACTGGACAACACCAATAAGCAATGTAAGCATTTTCCCCTCTAAAGTCTTATACCTAATTACCTATACCTATATATAATTATATAAATTATCTTGCAGACTTCCTTATGCTCGAGAACATCACATCGCAGTTCCGCAATCCCTGCATCCTGGACCTCAAGATGGGCACTCGTCAGCATGGAGATGATGCGTCGGCGGAGAAGCGCTCCAAGCAGATGGCCAAGTGCGCGGCCAGCACATCCGGATCGCTCGGCGTTCGCTTGTGCGGAATGCAGACCTACCTGGCCGATCTGGAACAGTATGCCAAGCGTGACA


Search Again