CR00608

CRIMIC CR00608

Gene CG6472

CG6472

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78965

Images

Construct Sequences

sgRNA sequence
CGCCAAGTTCATGGCCAAGTTGG

Amplicon 5' Amplicon 3'
AAACACCCACGCTTCGATGATAATATACAAGTTTGGCTTACAGCATAATTTATTAAATTTAGGAATTAATTATCAGCACTTGTTCAACAATTAGAAACTCAGGGGGAGAAGACCATTCCAAAGTTGATATGGTTTTTTATTGAGCAAAACGGAAGGTGATAAGTGGACGGAATCGCAAATGAGTCCGGCAGTGAGTAAGGTCAACGTCATTGTTAGTTGGCATCTAATCAAGTGTATTATCCGTATGCATTCGCAGCTGACGATAAAAATGTGTAGCAAAACAGAGAGTACGAAAAAGCCGTCATTGACATCCCAATGTGGTTGACCCACTGACGGTGGTGTTGCCTCTTAAAGACACCACCCACTCGCGAATCGATCTGATTAAGCACTTGGCCGTGTGAACATCGAAAACCTGATGGAAATGAAAACTTGTTTTCATTTTGCCACCGCTGCTACGTAACACGCGGCGTATGCGTCACGTGCTGCCTAGTGGCTACTGCCACTTGTGTTTTTGTTGGCCCCACAATACATGCCATTCCACTCGATTTCATTTACTCCCGCCAAGTTCATGG TCTTCGTTAGGCCAGTTTCGATTTCTTTGCTACTGTTTTTGTTTGACTTTTGGTTTTCATCTTTGTTATTACTTTTTTTTGGATTGTTATGTTATGGCTGCGGCTACCTGGTTGTTGGACGCGTGGGTTAATGAAGCTAATGAATCAATTAGTTTTGTATTCCAAGCTCTCAACAAATTGGCTTGCGCTTACCACTTGACAAATTCGATTTCCGCCTTCATTTTGTGGCTACGTTGTAAGAAGTTGCAGAACAATTTGCTTACAAACATTTTGTTAATTGGTTTCCTTTCAGTAAGTCTTTTGACAAAATAACTTCTTATTTCTTTTATAATTTCCTATTTGGATTGTATTTTTTTTGTATATCCCAGCTGGTTCACCGATTTTCTACAGCGCCGCTCCGCGTGGATCCTGCTCCACTTGCTGTGCCATTAAAGAGCGCGAGGACATAAAGTTCATGCTGTACACCAGGTAAGCAAGCGGCGACCCATCTTCATTTCATCCCAGCTCATGCATATTGAGGGGCCATCAAAAATGGGTCCACCTTTTGCAGTCGGAACCGCAATTCCGCACAACTGCTCCACCTGAGCGACGATGCCCGGCTGGCGCAGAGCAATTTCAATTTCAATTACCCGCTGGCCATCTATCTGCACGGCTTCTCGGAATCGGCCACCGGCGAACGGCAGAGCAGCCAGGAGCTAAAGGACGGTGAGTGGGGACTTCCTGCCACCTCGACCAAAAAAATCAACAATATATACCCTGTCCATCTTCCATCCCTGTCCGATTTCCCCCGGCAGCGTTTCTCAGGAGGGGCAACTACAATGTCATCCTCATCGACTGGAGCGCGATGACAGCGGTGCCCTGGTACTCGAATGCCGTCGAGAATCTGCCGGTGTCGGGTCGCTATTTGGCCAGGTTCCTGCGATTCCTGGTGGACAAGGGTTACCCAGCGAAGTACATCCACTTGATTGGCTTCAGTCTGGGCGCCGAGGTGGCCGGTTTTGCGGGCAAGCAGCTGCAGGAGTGGGGCATCAAGCTGCCCAGGATAACGGCCCTCGATCCAG


Search Again