CR00607

CRIMIC CR00607

Gene CG30265

CG30265

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK OK78964

Images

Construct Sequences

sgRNA sequence
AGTGAACGATGGACTTTATCCGG

Amplicon 5' Amplicon 3'
GGCTGGTCCGAAGTAGCTTTAAATAAGTCAATTGTGTTCCCAATGAGTACTTTAAATATAGAAACTATACGTGAATAATCCCATGACCTTGTCGATTTACCTTTCGGAAACAGGCCCACCAAGGCATCATGTCAACTGTTTATCAATGAAAACACTGATTACTATAAGAATTTCGGAGTACTGATCGTAAATAAGCAATTGACGTGTGTGTTACGGAAAAATAAGATCGATCGCTTCTTCAATTAATTTGACATGTGTTTCAACTACCATTGAAATTTCAACTAATTTCGATAGTTCGATAAGAGGGGGCAAGGCGTCTCAAGTGTTCTGTTGATAAGTACGTGGGAATATTGTTGCTAGTGAAAGTATAGCACAATATGTTTATGACCTTTGAATTGGCTAGCTTCTCAGACTTTACGCTGGGCTTTCCCAGATGCCACAGCTACAGATACCAAGTAATCAAGATAACGCATTGAGCTAGGTCAGTTTTTCACAAGATTAAAACGTTGATTATGAGTTGGTGATTAGTGGGTGTTAAATTAAACATATCAACGGGTGGTAGTGGACTTCGTCTATCTACAAATTTGATTTACAATACTAATCTTGGACTAACAAATGACTTTCCCACTTTTGCCATGATCCTAATCGCGTGCCACATTCGCTTAAGAATACACATGAACACTTTGTGTTAATACGCACGCGTTTGAGCCTTATCACAGGATAATCAGCCTGATTAGCTAGAAGTTGATAAACAACTCGTACGATTGAAATCGCAGCAAGGTGCGTTTGACTCGAGTTCAATTCCATTCTATTCTACCATTTCGAAGGCAGAAGGTCAATTTTCGATCAACACTACAAGGATGACAGCTGAAATAAATAAAGGTATGGGAAAAATATATTCTTTTGTATTCGGGTAAGTTCATGCATTCCTTTTTTCATTTAACGTTCGCTAAATATGAACTGTTCGAAGTGAACGATGGACTT AGTACATACTTGGGTTAGGTCCATTAATAAACCAAACCTTTAAACCCTTGCCAAACAGTGTGATTTATTTAAATTTTTTGCTGACTAGTTCGAAGCCAAAAGCTAACGAGTTTTCTTAATGACTGCAGGACCCCTGCTGGGAATGCGACACGTTCAAACCCTATTGCTTTTTTTCAACATCACGTGTTTGTACATCGGTCGACTGAATGTGGGAGTAGCCGTGGTGGCGATGACAAACGCCGAGTCAACTAATCCCGATTTTCCAGTAAGACTTTTAATAACTCCTTAACTCTTTAGTCAATAACTTTCATCACTTTTTTTCTCAGGAATACGATTGGACTCTGACCCAGAAGTCGTACATATTATCCAGCTTCTTTTGGGGATATATCATCACCCAGTTCCTGGGCGGATATCTGTGCAAGCGTTATGGAGTCAAGAGTGTCATGCTCTGGGGCTCCTTTGCATCGGGTATCTTCAGCGCTTTGACCCCGCTCTTCATCGGATTTGGTGAATGGCAAGCCTATTGCGGTATTCGAGTCCTGATGGGATTTGCCCAGGGCCTGATCTTTCCCTGCATCCATCAGCACTTGGCCAGATGGTCACCGCCGGCGGAGAGGAATCGCTTGGGTGCCCTCAGTCACACAGGAATTGAGTGTGGCAACGTGTGTGCCATGTTCTTCAGTGGAATGATAGCCAAAAGTGCCATTGGCTGGCCTGGAATATCGTATGTCTCTGCAGGATTAGCCTTAGCCTGGTGTGCATTTTGGTTCGTTTTCGCTGCTGACAATGCAGAGGAATCTCGTTACATAACCCAGGAAGAACTCCACTATATCGAATCGTCTCTGAAGCACAATGAGGACTATCACAAGACCGTAATTCCCGTTCCCTGGATGGCGATTTGGACCTCGGCACCGTTTTTTGCTCTCATGGTGGCGCGTTGCTGCGAAACCTGGGGTCTGAGCACCCTCCAGGCCCAGATCCCAACGTATATGAACGGGGTTCTGGACATG


Search Again