CR00605

CRIMIC CR00605

Gene CG11034

CG11034

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band80606

Images

Construct Sequences

sgRNA sequence
AAAAAGATGATAATTCACCGCGG

Amplicon 5' Amplicon 3'
AGTCAATCTACGGCTTGGGCAGGCGATTATTAGCTTTTAATGGTAGCTGGCAAACGGGTAAGCCTCCTAAAATTATTACTGATAAAGAATTAAGTTGAACGGGATTTATGTAAATAGTACAAGTCTAAATACTTTATAAGGCAATCCCTCTGAACATTCTACGTATAAGTGTGATCTTTGTTGTCAAGTGTAGGTTCTTAAGAGCGCTATAAAACTAACGGCATCTGGCAACGCCGTTCCGCGCTCAACAGGTGCCTCTCTCCCGCTCTTTGTGATTGTAATTGATTTCTGATCTCTACTCCGACGACTCCGGCTCAGTTGCATTCTAGCCGCGCCGCCGACTGTTGCGTGTTGCGGACTTCGCGGAGTGACAAGTTGCGATAAACGATCTACGTTTCTCTGGCGGCATTCAACATGCCAATTAATCCGCTGCTGATCACAGCCTTTGGCCTCTTCATCACCGTTTGTCCTCGTCCGTCGACGGCGGCGGCGGTCATTGGGCGGGTGGATGGTGCGGAGGGCAACAAGACGGCGTGGGAACTAACGGAAGCTCTGTACGGCACATCGGGGCTACGGAGTTTCAATGGCACCTGGATAACAGGTTCGTTGCTCATCAATCCCATCGGTTCGACGACCCACTGTTTGTTGTTGTTCTTCTTCCATCGCACCACCAATTTGTATTTGTTTTTATTTTGAGGCGGCTATCACC ACCCGCGGTGAATTATCATCTTTTTGGAATTGGGAATTAACATCCGGGGAATTCCTACCGCGGGTGCTCCGACCCTTATCAATGGGCTAATTTACGTATATTACGGCTGGGCCATTCATTCCCCCTATATAGTAGACCACCGAAGAAAAGAATAAACTTAAACCTATAATACTTAACACTTTGATATCAAAAAAACTGGCAAAACTTACATATGGAGCTTAAGTTTTGGCTAGTTTATTACATTTAATCTTATCTTAAATGAATTACGATCATCATTTTGAAGCTCGATAGTATGATTATTGTGTGTTTCTTATCTGCGACGTTTGGTTAACCATAATGGCAGTGTTCAGATAATGGAAAAATCTAAGATTTGCTTTCATTTGAAACTTCTAAGTTATATCATTGCAAGAGCTAAGTAATACGAATTTGATCGAATTCGATGATTTCTTTGACAATGTTGGAACTTAAAGTAGGATTAATAATCCACGGTTCTTTTTGAAGACAGTTTTGAAACTGGTGCGATGTCACATTTCTCCAACTTAACTTCCGACGTACCAAATTTCTAGTTGCCTCTTTTCTGGCGTAATTCCAGATGCAATCACACGCTTAACTTCAAACAGCTGCACTTCGAACTTGTATACACTTAAATAGTTAGTTAGGGTATTTGTATTTGTATTTGTTATCTAACCAACGTAAAATCTAAAGAATGATAGAAAGTCAGATACCCTATAAACGGTTCTTTGATTTTGGTCAAATGCACTATTGCAGATGAGGAACCTACTACACTGCAACCGACCGATCCATCCACAAATTCAATGCGGCCACCAAGACAGATGTGA


Search Again