CR00604

CRIMIC CR00604

Gene daw

CG16987

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p1 OK no band80605

Images

Construct Sequences

sgRNA sequence
CTTATCTGGTAACTGACCCCAGG

Amplicon 5' Amplicon 3'
ATGACACTCTCCCATCCGGACGATAGCACCAAGAACAAGGAGCTGGACGATTACTACGCTCGCACTAGCAAGAAGTTCATACTGCTCAATAGAGGTAAGCAAATCTAGATTTAAGCACTAGAAAGTAAAGATTGAAGCTTAACTTCAAAGGGAATCCTTTTACCATTCTGATTTTGCTAACACAACCCTTTATCCTTTATTTTTACAGAGGAGGTCGAGTGCAACCGAGCGAGAGATGGAAAATCCAATCCGTCCATGTGCTTCACCTTCAAGATAGACGACGCAGATGCCGAGGGCTTCGACGTGAGCACCGCCGTCCTGTGGCTCTTCAAGAACAAACAGAACCGCACCGACACGGCATCGGTGAACAGCACCAGTGCCCAGCAGACGATCGTAGTCTCCGAGGTGGAGGTGGATCAGCAGAAGGACTCCAAGTATTTGTCGGCGGCCAAGACCATAGCCATCCAGTCGGTGAATGTGCAAGGTGGGTACACATAGTATACATTAGTATAGCATAAACACTCATCCCCCCAGAGCGTAATCATGCCCAGAAAAGAATCGCACACGTTTGGACCTTTGGTCGGCAGCCGCGGAACGGCCAAAACTGACCCTCAATACCCTCGGGGGACAAATCAAAATATGTGACATGTCTATACTAGATGGGTATTATAAAAATTATAAAGAACGCCGATAAGTGCCAACGTTGACAACCGCTTGTTTGTGTTTTCAATTAGACAGATCATTGCGCAGATTCGTGATAGCACTGCTTGATAGCTCGGCTCGAATCTGAAATTCATGTGGGTGAATAACTTGACAAAGCATTATTCGTGGGTGCAAAAACTGAACTTTGGCCACAACCCAGCACAGTTGTGAGT TGAGTTCCTGGGGTCAGTTACCAGATAAGAAAGATGGGATCTACGATTCTGGGAGAAGAGAAGATGGCTCTGTGGAACCCCCAACTAACCGCTCTGCCTTTCCTTTCGCATACTTTCAGATGAGTGGATGAAGATCGACATTGAGTGGCCCATCAAACACTGGATCAGTGGCCACGAGCTGAGCCACCTCATCCAAATCACCTGCGGTGGCTGCGATGTCAGCGACATGGAGGAGATCATTTCGGTGGACAAGGATTACCGGCCATTCATCGTGATCGACATGCAGAACAGGCGGCGCAAGAGTCGCCAGAAGCGCAGCATCAACTGCTCCAGCGGAATGACCGAGTGCTGTCGGGAGCACCTGTACATATCATTCCGGGACATCGGCTGGAGCAACTGGATCCTGAAGCCGGAGGGCTACAATGCCTACTTCTGTCGCGGATCCTGTAGCTCGGTGGCGAGTGTTACGCAAGCGGCCTCCCACCACAGTTCCATAATGGTAGGTACCCCATTCGACAGGAACTGATGTGTTGATGATGAAACTAATGTATATCCTCTTCCCTTGCAGAAAATTCTCTCCACGAGCGGTGCTAACAAGTCGCTGGAGTTGGTGCCCTGCTGCACCGCCAAACAGTATTCCTCGCTGCAGCTGGTCGTGATGGACTCGAGCAACACGGCGACGGTGAAGACGCTGCCCAACATGGTGGTGGAGTCATGTGGCTGCAGATAGAGAGGCGAATAGAATTAGCCAAGTTACATTTACGTTACATCGGACAAATTAGACGTAGACTCCATTTCGCTCCATTTCAGCTAGCATCCAACCATCCAACTACATTTCTCTCCAACTAATTTAAACTCATTTTGCAAAGCATTTACATTAGCGTTGTCATTTAATCGTAGTTACCTGTAGTGCCTGAGCTGCCACTAGTTGA


Search Again