CR00601

CRIMIC CR00601

Gene HDAC6

CG6170

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78963

Images

Construct Sequences

sgRNA sequence
ACCGCACTGTACCTGTGCAATGG

Amplicon 5' Amplicon 3'
AGCTCGGAACAACATGCTCAAGAATCAGGGCTGCGGATCGCAGGAGAGCGTCACGGATATATTCCAGAATGTGAGTGCTATCTGACTGACCTCTATCCTCTGTCCTTGTGCAATCCTAACCAAGTGATATTTAATCGTCGCCGACGAAAAGGCTGTCAACAGCAAGAGTCTGGTGCGGAAACCAACGGCACTGATCTACGATGAGTCCATGAGCCAGCACTGTTGCCTGTGGGACAAGGAGCACTACGAGTGTCCCGAGCGCTTCACACGAGTCCTGGAACGGTGAGTATATTTGAAGAAAACGGTACAAATTAAGCTGATATGTATTCCCTAATCTCCTCATCCAGCTGTCGCGAACTAAATCTGACGGAGCGCTGCCTGGAGTTGCCCTCGAGATCGGCGACCAAGGATGAAATTCTGCGCCTGCACACAGAGGAGCACTTCGAGCGGCTGAAGGAGACGTCCGGGATTCGCGATGACGAGCGCATGGAGGAGCTGAGCTCCCGCTACGATTCAATTTACATTCATCCGGTGAGCAAGCGCATCCAACGGGGAACATGGAACAGTGCATCCCAGTGCCTGGCTCCAAATTAGCTCATTTTATTGTATTTGCACTTGATTGCTTGCGGAGATTGCGTTGTTTTTAATTCGACGGCTTGATAAATGCAAATTGGAGCAGATTAGATTAGATGCGACCCATTGC CAGGTACAGTGCGGTGCATAAATGTAAATGGTTGAGTGACTGGCATAAATTATGCAAATGATTATACCTCCGAACTTAAAATGCATTTATTCCCCGATTGTAATTCTAATATGTCTATTCTTGTTGTGATATTCATTATCTTTATATTGCGTGCAATCTTTATTTAGTTTGCTCAAACTTTAGTTATTAATTATTACGACTGCCCGCAGCTTTTATTACTTTATATTTCATTAGCTAAATCCTCCAGCAATCTGAAGCGCACTGTAAATTCGTTAAAATGGGCTGGTACTCATACTATTACATCCTAGATAAGATTCCCGCTGTTTTACTAGCACCGAACTTGTTATATATAGAACACTGATAACCTTATCCGCCTCCCACCCGCAGTCCACATTCGAGCTCTCCCTGCTGGCCAGCGGCTCCACCATCGAATTGGTGGACCATCTGGTCGCCGGAAAGGCGCAGAATGGCATGGCCATCATCCGGCCACCGGGTCACCATGCGATGAAGGCCGAGTACAACGGTTATTGCTTCTTCAACAACGTGGCACTGGCCACCCAGCACGCCCTCGATGTTCACAAGCTGCAGCGCATCCTGATCATCGACTACGATGTGCATCATGGGCAGGGAACCCAGCGGTTCTTCTACAACGATCCCAGGTAAAGTTGGCAATATATGTTTAGTATTCTCATTCATCGTGTGTGTGTTTCAGGGTGGTTTACTTCTCCATCCATCGCTTCGAGCACGGAAGCTTCTGGCCGCATCTGCACGAGTCGGATTACCACGCCAT


Search Again