CR00600

CRIMIC CR00600

Gene CG34325

CG34325

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 no band OK80604

Images

Construct Sequences

sgRNA sequence
CACGACTTGGAACGCCCACTTGG

Amplicon 5' Amplicon 3'
CGAAATATCGTGCGGCACACAGTGCGTATACGTGATGGCCATTATCCCATTTAAACTGTGAGTGAAATGCCGAAATAATGGCTTTGTAATATACGGCAAATTGTATATACATACGATTATCTGCCGGGAAACTTTTGCGGAAGATCGATGGAGCGGATTATTCAAAGACTTATGCATGGCGAAAAACATTGGAAATTTTACTATTCGGAAGGCTGCAAATTTATGACAACATCTTTTAAATAAGTTAAGATAAAAAGGAAGCTAGGCATAAATTTAGACAATTGCTAGAAAGTTTAATTTATTTCAAGATGAACAAAAAAAGCAACTAATCGCAACATAAAGAGACACTAAAATATGTTATAAATTACATAGAGGAAATTGCAAATCAAAGGCATTTAAATAACATAAACAAATAGAAACGATAATGGAAAGTTTTTGTATAAAACATATCTCAAATGAAAACAATATGCATATTTATAATAACAAGTGAGTTGTTGAAAATCTATAAAAGAAGACCCAGTTTCTATAGAAACCTCAAGTAGGCCAATCGAGTTGTTAAGAAATATAAAAGCAAATCGTTTTCATTCATCATTTGCAGCAACTATTAGAAGATCACAAAACCAAAGTCAAATGACTGGTGTGCTTAGAAAAGTGACAAGCCCAAAAAGTAACATTAATTTCCTTGTGTTTTCAGTGGTGGTTAGTCGGGTGAATAAACCAATTTCATATATCAGTCGTCGAGACACTGACCAGACTCCATCACTCCCTCCCCGATTCCCAATCCCAATCCCAATCTCCAGCCCTGTCTCTGTCCCTCTCCAGATCACGATCGTTATGGTGATGGTGATGGTGGAACATAACGATGATCGCGGTGATGACTCTTCAAAACCTTTTGGTTAAGCAGGCTTCGCCAAAGTGGCTGATTTATATGGCTCATTTTATTAAGCGGACAACGAATAAATCGCTTTGTAAATTGATGATATTTTGTGTGTAAAAAGCAGGGGGATGATATCATCCGAGGCGAGATGTTCTGGGCTTAGCTTAACCTTAGGACGCTAACTATATATTATAATGTATATGGCAAGCGGGGCCCTTAATCCGCACTTTTGCTATCGCCCACTGATAAAAAACACTATTCGAAACTCAAATATTTTCCAAAACACGACTTGGAACGCC GGCAGACTTGGTAACTCTTGAAAATCACTACTATTTCATTATTGTTTTTTTTCTTTTTTTTTCATTTTTCAGTTTTAGTATGGTAATTAACATAAAGTCTAATAAGGCAAGGCAAACCATATTCGAGTGTGCGTGAATTTTTATTTTTGTTTGTTTTTTTTTTCTCGCTGATTTTTGTTTTTTCTTTTTCTTTGGTAGCCAAAAGCCAGATGGATGACAATTTCAGTTGGGTTTAGTTGATTTCGCTGGCAGTTGACACTCTCAAAATTCCGCTCACACATTTGTGCCATGTACATGGAAAGCTGACAACTGAAAACTAAAAACTTTCGGGCCGAAAATCGAAAGCGGAAAACTTAGCACACACACACAACACACAGCACACACCGAATGGGTGGCCAACGCGGCGTATGAGCAATCTGCAACCTGTTTGAAAAACGCCCACGCCGGAGATTGGGGATTCGGATTTGAATTGGCTTTGGGTTTTGGGTATTGGGCCCAGCCAGCTGGGCGACCAGTTAGTTGGAA


Search Again