CR00595

CRIMIC CR00595

Gene nudE

CG8104

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78962

Images

Construct Sequences

sgRNA sequence
AGACTCAGTTTGCGTATATGTGG

Amplicon 5' Amplicon 3'
TTCCATGCAGTGCGTTGTTGTATGGGAAACTTCGTCGTAGCTATTTGTTGTTGTTGTTGTTGCTGCTGCTCATCACCATCATCCTCGTTGTTTTCGTTGTTGTTGCCGCAGCAGCTGCGTCACAAAAATGAGTTTTGTTTAATTTGATTTTATTTACATTTGATATGGACAAAACCGACTGCCCTTTTAGGGCATCGAACAAGAACAACAGCAACAGTAACTACAAAATTCAGGGCAAACACCTGTTCCTAATTGATTTTTCACTTTTCTTCGCCGACTTCTAGTCTATTCACCACCCCCAACACACAAAACAAAAAAAAAGTAAAACTACGACTTGAACAACAACTGTGTTTTGGCATTTTAATCACAGCAATTAAAAACAAAGCAGCCAAAAAACACGAATAAATAACCCAAACAGTAATAGACCAACCGTAGTACATAGCATTGTTCAGAAATTAAAAGTTAAATCAATTCGAACGAACGAAATTACAAACCCATTTTGACCGCCGATTAGTACACAAAAACCAGAAAAAGGAGTTAGCAGCTAAGGAAAATTTGCAGAAATGGAGTCGCCCCCGATGTTCAATAGTGTGGAAGATGAGTGCAGATATTGGAAGGAACGATCTAAGCAGTACCACAAAGAGTAAGTGCCCATCCCTATTACAGTCTCCGAAATCAGCCATATAGCCTAGTTTTACTTTTAATTTTCAGGTGGACAGACGTGAAACAGGAGTACGACGAGTTTGTGGAGCAGTCCCGCGAAATGGAAATAGAAATGGACGCCACTCTGGACCAGAAGCAGAGTATAATCAAAGATCTCACAGCCAAACTCACAATGTTTGAGCGGGAAAACGAGTCTCTCAAGGTAGCTATAAGCTAAGCCCGATTTACACAAACTGAGCTTAATTCTTAGACTCAGTTTGCGT TATGTGGCTTTGAGCTCCCGACAAGATTAGTCTTTACAACTATTTCATTCTCAGCTCAAGTTGGAATCGCATGGCATCGATATGTCAAACATGGAGAAACAGCTGGAAACGGTGAAGAAGGATCGCGACACCATGAAGGTGTACCTGCGGCAGCTGGAGCAGAAAAACGACGATTTGGAACGTGCCCATCGCATACTTAACGAAAGCATAGAGAATTTCGAGAAGATGCTGGATCAGGCCTACGAGAAGAACGCCCTTCTGGAGCTGGAAGTGGATGAAAAGGGATTGCTGCAGGAAAAACTACAGCGATTAATGGATGAGACGAGAGGTGGATGCATCTATACCAGATGTCCAGCACAGACTTTAAAACTAATTCATCAAATCTATTGCAGATCTCAAACAAGAGCTGAACGTCAAGTCACGCTTTACCCCAGTGGTCAATGGAACGAGCGTTCCCACGGCAAACGACACAAATACGGTCAACAGCTCGATGAACTCGTCCGCCTCGCTGCCAAATGGTATTGTTGCCAATGGCGAATTGGTAAAACACGACAATGCTGTCGCCACAAGAGCCACCAGCGTCAGCGTCAACGCCCTCAATGGCAGTTTAGTTAATAGAAACGAATATAACCAGCAGCATTCGCTTAAGAGTAAGATACTAAGTTCCCTAAAGAAAACCAGACGCGCGCTAAAACTGTCCAAGACGAATCGCCAAACGTTCAAGCCATGCATTTAGTATTGTTTTTCCATTTGTTTCTTTTTTACTTGTTAACCAAAAAATGTAGCCCGCTTAAGTTCCTCATAATTTGTAATTGTATTGTAAATTATTAAAATTAAGAGCCCAAATGTGACGAAAGAGTTTGCAACATTTCTTGTAGGCGATTTTTGTACGATTTGTGTTTGCGTCTGTAGCTAGTAGTTGACCTAACTAACCTCTCGACTAACATGCTGTGTACGTGTGCTTCCTCTTGCAGATCCCGAGAATCAAATCAATGGCAATTCCATGAACCCCAGCTCCCGCACAACGGCGCTCAACATTGTGGCCGACATGTTAAGAAAACTAAACGTAAGTCCCTCCGCAAACT


Search Again