CR00594

CRIMIC CR00594

Gene fbp

CG31692

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p0 OK OK78961

Images

Construct Sequences

sgRNA sequence
TAAATGTGGCTAGAAGATATAGG

Amplicon 5' Amplicon 3'
CTAAGTGCCTCCTCCACGTCGGACTTGGATCCTAGGAATATGGGACTGCGCTCGTGGATCTTCTTGGGCACAATGTCCAAAATGCTGATCTTTCCGTCGCTGGCCAGACCTCCAGCCTGGATCATCAGATAGGCCATGGGCACGCACTCGTACAGCAGACGAAGTTTTCCGCTGGGAGCGGACTTTGTTGCCGGATAGATAAAGATGCCGCCGTATTTAATGGTGCGATGCACATCCGCGACCATGGAACCCACGTACCGCGCTCCATAGGGCTTTCCCTTGGCGGGATCCTTCTTGGCCGCAATGTAGTTGAAGACACCATCCTCCCAATCCGCTGCATATCCCTCGTTGATAGAGTATATCTTTCCCTTCTCCGGCACCCGCATGTTGGGATCGGTCAGCACGAACTCTCCGATGGCCGGGTCATAAGTGAAGCCATTCACTCCCGAACCCAGACCCAGGACAATTGCTGTGGCCGAACCGTATAGCGCGTAGCCGGCGGCCACCAGCTGATTTCCGGGCTGCAGTGCATCCTCCACTGTGGGCGGACCATCGCTTTTCTTGCGGTAAATGGCGAAGATTGAACCGATCGACACCAGGCAGTCTATGTTGGAGGATCCATCCAAGGGATCGAAGCACACGATGTATTTGCCCTGGAGGTGGAAGAGCGAATAAATTATAGGGAAACGTCATTAAATGTG AGGGTTAGATCTTAGAGATAGAGCCATCTTAACTGACAGCTAAAAGCTAATTCACACCCTCATACCAAATTTCGTAACAATTGGTCACGTATTAAGGCTTAAAGACTCTAATATATCCCTACCTGTTTCTCCACTTCCACCTCGATCACATTCTCGTTCTCCTCGGAAACCATTAGACATGTGGTATAGGATGACTTCAGCATGTTGATGAACAGCTCGTTGGAGAGCACGTCCAGTTTCTTGACCTCCTCGCCTTGGACATTCACGTCGCCAGCGAATCCATGGAGCTTGGCGATACCTGCCTTCCGCACCGCGGATGATGTAGCCTTGATGGCGGTCTGGATGGAGTTGAGCAGCTGGGAGAGATCGCCAGTGGCGCTCTTGAACTTTCGCTGCTCCTGCAGCACGAAACGCGTCAGCGTCATCGCATTGGAGTCGAAAGCTGGCCTCTGTTGGGTCATTTTGGCTATTTTATATGCAAAAAAATTTAGTTGTACAGTATAATTCGCTTAGCTGCCTCGAGTACTTTGCACAATGCCTCGATGCAGGTAACTTAAAAATGCAGCTAACTTAATTTTTTTTTTTTCTATTTTCTATTTTCTATTTACACAAAAAAATGGAAAAATAATGCAGATATCTTGCCGATGCAGCTAACTATCGATGCAGCTAAGCGAATTATACTGTAGTATAAAACAAGATTTTAAATTTTACTGGATATGATTGGGAGAGGATTAGCATAGGATTGGAATAAATCGATTAAATATTAGTAATATTACTTTGTAAGAAAATAAAGACAACGAGCTAAGTAATACATAACATATATAGGCAGTGGAAAGGATTTAGGATGGATTAAATGTACAACTGCTGTACAACTGAAGCGGGGT


Search Again