CR00593

CRIMIC CR00593

Gene Hexo2

CG1787

Information

Donor HA-L PCR HA-R PCR Stock number
pM37-p2 no band OK80603

Images

Construct Sequences

sgRNA sequence
GCCAACGGATAACAAATGGTTGG

Amplicon 5' Amplicon 3'
GTATGTGGGCCACTCTCCAGGGGGTGGGGTTTGCTTCAAAGAGTGGGAGATATGCTGATTTCACAGCACTACACAGGCAGAAAAGACGTGGCACTTCATGCATCAAGTGTCCTGTTAGTATAGGGAAGCTCATTTAATAAAGCTGTAAAATCTAATTGCCAAGCATTAATGTGGAGTAGCAGTGTAATGCAAGGACTTGGCGTTTCTCGCAGTGTAATTTCAATCCGCGCTCTCTCGCGCTCTTGCACTCTCTTCAATTCAATTGACGATAAGCTCGACTTGTTATTGCTGTTGTTGCGGCCGCTACTGCGCTGCAAGTGAAATTTCGCTGGATTTATTTTATTCGCTTTTTCGATTTCAGCTCTTCAGTGTTGTTGTGCTCGGCGAGCGGAGCGGGTGGGCGGCCGGTTGAAAATAGCGAATACACCGTACACACCCCCCTAACACAACAAATATAGCAAATACCGAACAGAAATTATAAAAGCGAGCGGCGCAGCCAAAGAAGCCGTTAGAAAGAAACGATGCGGTTCAGCGGCTACAATCGTTATCAGTGCTTTTGCTCTGCTGTTGGATCGCTGCTGCTATTATCCCTATTATCCTTCGCGGTCGGCGCTGCGCTGACGCGGGCAGATGACGTCGGCAGCGACGCCGACGCCGGCAGCGCCAGCAGGTTTGTGTCTTTGCTTCATAAAGGAAATCAGTGCAACAAGTGCAAGTTTTTTTTTAAATACATGTTTTGTTTTGGAAGTATAACAATTTTTGCTAACAAAATGCAGTGAAAATACAAAAAACTGACTGTTCTTTATTTTCAATGAAATTTCAAGTGTTATATGCGCTCAGCAGACTAGTGAAAAAAAGTCCAAAAAGTCCACTACTTTTAAATATATTAAAGGAAATCTATTCATTCTACAAAAGAGAACTTTAAAAAACTGCCAACGGATAACAAA TGGTGTCTATGCTCAGCAGGATATCCAATATCTCCTCAAATAACTGAGAGCAACAAGTGAAATCAGTCTTAAAAACTAGAAAATAAAACAAACAGAAGAAAACAGGTGAAAATTTAACTGTGCCAAATGCATTTACATGTTAATTTGCATTCGCTCCAAGTGCAATTTTCGTAAAGGGAACAAGTGCAAAAGGCAAAGCGACAGAATAAGAACTACTTTCTATGCAGCTGCATATATTATTGAAAAGAATTTGCAATAAATAAAGTGAAATCTGCTTTATGTATCTAAATATATATGTACTTAGCTTTATTATAGCAATATCTTCCGAATTTCCAGGAAATGGCTGTGCAGCCGGACGGATATCTGCACCGCGGAGGGCGAGATGGTGGCCGGACTGCAGTACGCGCCGGAGATCTTCGAGAGCCAGCGGGATTGCCGACTGTCGTGCGGCAAGTACGGAGCCATCTGGCCCATGCCCACCGGCAAGGAGTGCACCATATCGCACAGGCGGGTACGATTCGATCCGTGGAAGGTGCGTTTCCATGTTGTGGCGCCCGGCGAGGCGGCCACCCAGTTTCTCAGGGAGACGAACCGGCTGTTCGTCTCGAATCTGCTGAAGGAGTGCATACGAAACTGCACGCTGGAGACCAGCAAGCAGATTCTGGTCAGATCCACGGTGGCCAACGAGAGCCTCGTTCTGGACTGGCCCACCGACGAGAGCTACGCCCTGGTGGTGCGAACCACTGAAACGGCCACCTTTGTGGACATCCAAGCGACGACGGTGTACGGTGCACGTCATGCCTTCGAGACGCTGAGCAACCTGGTCACCGGCAGCCTGTCCAATGGCCTGCTGATGGTCACCACGGCCAACATCACCGATCGTCCGGCCTTTTCGCATCGCGGCGTCCTTCTGGATACGGCCCGTAACT


Search Again